Previous Contig 003500:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS036F11Sequence639003500 (9)gb:AC005171_15323155e-59Arabidopsis thaliana chromosome 2 clone T4E14 map mi310, complete sequence.>gb:B
JMFS046B02Sequence406003500 (9)gb:AY050658_15622712e-50Arabidopsis thaliana HUA enhancer 2 (HEN2) mRNA, complete cds.
JMFS072G09Sequence642003500 (9)gb:AC005171_15323155e-57Arabidopsis thaliana chromosome 2 clone T4E14 map mi310, complete sequence.>gb:B
JMFS076C04Sequence613003500 (9)gb:AC005171_15323152e-51Arabidopsis thaliana chromosome 2 clone T4E14 map mi310, complete sequence.>gb:B
JMFS096B05Sequence609003500 (9)gb:AC005171_15323155e-64Arabidopsis thaliana chromosome 2 clone T4E14 map mi310, complete sequence.>gb:B
JMFS098F02Sequence626003500 (9)gb:AC005171_15323151e-55Arabidopsis thaliana chromosome 2 clone T4E14 map mi310, complete sequence.>gb:B
JMFS111H07Sequence626003500 (9)gb:AY050658_1562271e-99Arabidopsis thaliana HUA enhancer 2 (HEN2) mRNA, complete cds.
JMFS124G02Sequence574003500 (9)gb:AC005171_15323151e-40Arabidopsis thaliana chromosome 2 clone T4E14 map mi310, complete sequence.>gb:B
JMFS137H04Sequence606003500 (9)gb:AC005171_15323153e-52Arabidopsis thaliana chromosome 2 clone T4E14 map mi310, complete sequence.>gb:B

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS111H07+ TAATCATCTTGACAATTTTGTATATG
                      ____________________________________________________________
consensus TAATCATCTTGACAATTTTGTATATG
 
. : . : . : . : . : . :
JMFS111H07+ TCAGAGACACCAGAAGCATTCCCACCTCTTGCAATTCTGCCACTTGACTTGGCATTCATA
                      ____________________________________________________________
consensus TCAGAGACACCAGAAGCATTCCCACCTCTTGCAATTCTGCCACTTGACTTGGCATTCATA
 
. : . : . : . : . : . :
JMFS111H07+ CTCTTGCTTCCATTTGCTGGATGCTGCTTGACGAAAGTATCCTGTACTTTCACAAAATTG
                      ____________________________________________________________
consensus CTCTTGCTTCCATTTGCTGGATGCTGCTTGACGAAAGTATCCTGTACTTTCACAAAATTG
 
. : . : . : . : . : . :
JMFS111H07+ TCCTCCCTAAACTTCTCAGTCTCATCAACTACAAGATACAATCCAGAACCGCCCACCGGA
                      ____________________________________________________________
consensus TCCTCCCTAAACTTCTCAGTCTCATCAACTACAAGATACAATCCAGAACCGCCCACCGGA
 
. : . : . : . : . : . :
JMFS111H07+ AACACATAATGCTGTAATGGGGTAGGGCGGAAATCGGTGTAAACCACATGGCATGGCTGC
                      ____________________________________________________________
consensus AACACATAATGCTGTAATGGGGTAGGGCGGAAATCGGTGTAAACCACATGGCATGGCTGC
 
. : . : . : . : . : . :
JMFS111H07+ TTATGCAAATTACATATCCATTCAGCAAACTCAGTGGCATTTGACATCGTAGCAGAAAGA
                      ____________________________________________________________
consensus TTATGCAAATTACATATCCATTCAGCAAACTCAGTGGCATTTGACATCGTAGCAGAAAGA
 
. : . : . : . : . : . :
JMFS111H07+ AAAACCATCTTAATAGCTGGCGGCAAGAAGATTATACTCTCTTCCCAAACAACGCCTCTC
                      ____________________________________________________________
consensus AAAACCATCTTAATAGCTGGCGGCAAGAAGATTATACTCTCTTCCCAAACAACGCCTCTC
 
. : . : . : . : . : . :
JMFS111H07+ TCACGATCTTTCATGTAGTGAATTTCATCAAATATAACCCAAGCAACCTCCTTCAACACC
                      ____________________________________________________________
consensus TCACGATCTTTCATGTAGTGAATTTCATCAAATATAACCCAAGCAACCTCCTTCAACACC
 
. : . : . : . : . : . :
JMFS111H07+ TCAGAACCCCTATAGAGCATCCCTCTTAGGATCTCTGTGGTCATCACCAAACAGCTTGCA
JMFS096B05+ CCAAACAGCTTGCA
JMFS036F11+ CCAAACAGCTTGCA
                      ____________________________________________________________
consensus TCAGAACCCCTATAGAGCATCCCTCTTAGGATCTCTGTGGTCATCACCAAACAGCTTGCA
 
. : . : . : . : . : . :
JMFS111H07+ TTTGGTGAAAGTGTAACATCACCTGTCATTAAACCAACATCAGAAAACTCTTGACTCAAC
JMFS096B05+ TTTGGTGAAAGTGTAACATCACCTGTCATTAAACCAACATCAGAAAACTCTTGACTCAAC
JMFS046B02+ CCAACATCAGAAAACTCTTGACTCAAC
JMFS036F11+ TTT-GTGAAAGTGTAACATCACCTGTCATTAAACCAACATCAGAAAACTCTTGACTCAAC
JMFS098F02+ CCTGTCATTAAACCAACATCAGAAAACTCTTGACTCAAC
JMFS137H04+ AAACTCTTGACTCAAC
JMFS072G09+ ACATCACCTGTCATTAAACCAACATCAGAAAACTCTTGACTCAAC
JMFS076C04+ CTCTTGACTCAAC
                      ____________________________________________________________
consensus TTTGGTGAAAGTGTAACATCACCTGTCATTAAACCAACATCAGAAAACTCTTGACTCAAC
 
. : . : . : . : . : . :
JMFS111H07+ TCTCTATATTTTTGATTGCTCAATGCTTTCAATGGTGAAGTATATATAACCCTTTGTTTG
JMFS096B05+ TCTCTATATTTTTGATTGCTCAATGCTTTCAATGGTGAAGTATATATAACCCTTTGTTTG
JMFS046B02+ TCTCTATATTTTTGATTGCTCAATGCTTTCAATGGTGAAGTATATATAACCCTNTGTCTG
JMFS036F11+ TCTCTATATTTTTGATTGCTCAATGCTTTCAATGGTGAAGTATATATAACCCTTTGTTTG
JMFS098F02+ TCTCTATATTTTTGATTGCTCAATGCTTTCAATGGTGAAGTATATATAACCCTTTGTTTG
JMFS137H04+ TCTCTATATTTTTGATTGCTCAATGCTTTCAATGGTGAAGTATATATAACCCTTTGTTTG
JMFS072G09+ TCTCTATATTTTTGATTGCTCAATGCTTTCAATGGTGAAGTATATATAACCCTTTGTTTG
JMFS124G02+ CTTTCAATGGTGAAGTATATATAACCC-TTGTTTG
JMFS076C04+ TCTCTATATTTTTGATTGCTCAATGCTTTCAATGGTGAAGTATATATAACCCTTTGTTTG
                      ____________________________________________________________
consensus TCTCTATATTTTTGATTGCTCAATGCTTTCAATGGTGAAGTATATATAACCCTTTGTTTG
 
. : . : . : . : . : . :
JMFS096B05+ TCCCTAAATGCCATTGCAATAGCATACTCTGCAACTGCTGTCTTTCCAGCAGATGTATGT
JMFS046B02+ TCCCTAAATGCCATTGCAATAGCATACTCTGCAACTGCTGTCTTTCCAGCAGATGTATGT
JMFS036F11+ TCCCTAAATGCCATTGCAATAGCATACTCTGCAACTGCTGTCTTTCCAGCAGATGTATGT
JMFS098F02+ TCCCTAAATGCCATTGCAATAGCATACTCTGCAACTGCTGTCTTTCCAGCAGATGTATGT
JMFS137H04+ TCCCTAAATGCCATTGCAATAGCATACTCTGCAACTGCTGTCTTTCCAGCAGATGTATGT
JMFS072G09+ TCCCTAAATGCCATTGCAATAGCATACTCTGCAACTGCTGTCTTTCCAGCAGATGTATGT
JMFS124G02+ TCCCTAAATGCCATTGCAATAGCATACTCTGCAACTGCTGTCTTTCCAGCAGATGTATGT
JMFS076C04+ TCCCTAAATGCCATTGCAATAGCATACTCTGCAACTGCTGTCTTTCCAGCAGATGTATGT
                      ____________________________________________________________
consensus TCCCTAAATGCCATTGCAATAGCATACTCTGCAACTGCTGTCTTTCCAGCAGATGTATGT
 
. : . : . : . : . : . :
JMFS096B05+ GCTGAGACCAAAACTGACTCATTCCGTTCCAAGCATGCGACAGAAACTTCTTGAAATGGA
JMFS046B02+ GTTGAGACCAAAACTGACTCATTCCGTTCCAAGCATGCGACAGAAACTTCTTGAAATGGA
JMFS036F11+ GCTGAGACCAAAACTGACTCATTCCGTTCCAAGCATGCGACAGAAACTTCTTGAAATGGA
JMFS098F02+ GCTGAGACCAAAACTGACTCATTCCGTTCCAAGCATGCGACAGAAACTTCTTGAAATGGA
JMFS137H04+ GCTGAGACCAAAACTGACTCATTCCGTTCCAAGCATGCGACAGAAACTTCTTGAAATGGA
JMFS072G09+ GCTGAGACCAAAACTGACTCATTCCGTTCCAAGCATGCGACAGAAACTTCTTGAAATGGA
JMFS124G02+ GCTGAGACCAAAACTGACTCATTCCGTTCCAAGCATGCGACAGAAACTTCTTGAAATGGA
JMFS076C04+ GCTGAGACCAAAACTGACTCATTCCGTTCCAAGCATGCGACAGAAACTTCTTGAAATGGA
                      ____________________________________________________________
consensus GCTGAGACCAAAACTGACTCATTCCGTTCCAAGCATGCGACAGAAACTTCTTGAAATGGA
 
. : . : . : . : . : . :
JMFS096B05+ TCAAGCTTAAATGGGTAGTTTTTTGCCATCTCTCCATTATAAACAGGATTCCCAAGAGTC
JMFS046B02+ TCAAGCTTAAATGGGTAGTTTTTTGCCATCTCTCCATTATAAACAGGATTCCCAAGAGTC
JMFS036F11+ TCAAGCTTAAATGGGTAGTTTTTTGCCATCTCTCCATTATAAACAGGATTCCCAAGAGTC
JMFS098F02+ TCAAGCTTAAATGGGTAGTTTTTTGCCATCTCTCCATTATAAACAGGATTCCCAAGAGTC
JMFS137H04+ TCAAGCTTAAATGGGTAGTTTTTTGCCATCTCTCCATTATAAACAGGATTCCCAAGAGTC
JMFS072G09+ TCAAGCTTAAATGGGTAGTTTTTTGCCATCTCTCCATTATAAACAGGATTCCCAAGAGTC
JMFS124G02+ TCAAGCTTAAATGGGTAGTTTTTTGCCATCTCTCCATTATAAACAGGATTCCCAAGAGTC
JMFS076C04+ TCAAGCTTAAATGGGTAGTTTTTTGCCATCTCTCCATTATAAACAGGATTCCCAAGAGTC
                      ____________________________________________________________
consensus TCAAGCTTAAATGGGTAGTTTTTTGCCATCTCTCCATTATAAACAGGATTCCCAAGAGTC
 
. : . : . : . : . : . :
JMFS096B05+ CCATGAACAGATTCATCCTTACATGAGGAATACCCACTTGGAACTGCCACCTCATGCACA
JMFS046B02+ CCATGAACAGATTCATCCTTACATGAGGAATACCCACTTGGAACTGCCACCTCATGCACA
JMFS036F11+ CCATGAACAGATTCATCCTTACATGAGGAATACCCACTTGGAACTGCCACCTCATGCACA
JMFS098F02+ CCATGAACAGATTCATCCTTACATGAGGAATACCCACTTGGAACTGCCACCTCATGCACA
JMFS137H04+ CCATGAACAGATTCATCCTTACATGAGGAATACCCACTTGGAACTGCCACCTCATGCACA
JMFS072G09+ CCATGAACAGATTCATCCTTACATGAGGAATACCCACTTGGAACTGCCACCTCATGCACA
JMFS124G02+ CCATGAACAGATTCATCCTTACATGAGGAATACCCACTTGGAACTGCCACCTCATGCACA
JMFS076C04+ CCATGAACAGATTCATCCTTACATGAGGAATACCCACTTGGAACTGCCACCTCATGCACA
                      ____________________________________________________________
consensus CCATGAACAGATTCATCCTTACATGAGGAATACCCACTTGGAACTGCCACCTCATGCACA
 
. : . : . : . : . : . :
JMFS096B05+ CATGTTCGAGTCAAATTGCGCCTTTTCGGGGCTGATTCTTCCTTTGGAACTTCTGCACCA
JMFS046B02+ CATGTTCGAGTCAAATTGCGCCTTTTCGGGGCTGATTCTTCCTTTGGAACTTCTGCACCA
JMFS036F11+ CATGTTCGAGTCAAATTGCGCCTTTTCGGGGCTGATTCTTCCTTTGGAACTTCTGCACCA
JMFS098F02+ CATGTTCGAGTCAAATTGCGCCTTTTCGGGGCTGATTCTTCCTTTGGAACTTCTGCACCA
JMFS137H04+ CATGTTCGAGTCAAATTGCGCCTTTTCGGGGCTGATTCTTCCTTTGGAACTTCTGCACCA
JMFS072G09+ CATGTTCGAGTCAAATTGCGCCTTTTCGGGGCTGATTCTTCCTTTGGAACTTCTGCACCA
JMFS124G02+ CATGTTCGAGTCAAATTGCGCCTTTTCGGGGCTGATTCTTCCTTTGGAACTTCTGCACCA
JMFS076C04+ CATGTTCGAGTCAAATTGCGCCTTTTCGGGGCTGATTCTTCCTTTGGAACTTCTGCACCA
                      ____________________________________________________________
consensus CATGTTCGAGTCAAATTGCGCCTTTTCGGGGCTGATTCTTCCTTTGGAACTTCTGCACCA
 
. : . : . : . : . : . :
JMFS096B05+ GTTGAACTTTCCTCTGCAGATTTCCTTTTAACCACTGTTGATGACAATTCTTCTGCTTTC
JMFS046B02+ GTTGAACTTTCCTCTGCA
JMFS036F11+ GTTGAACTTTCCTCTGCAGATTTCCTTTTAACCACTGTTGATGACAATTCTTCTGCTTTC
JMFS098F02+ GTTGAACTTTCCTCTGCAGATTTCCTTTTAACCACTGTTGATGACAATTCTTCTGCTTTC
JMFS137H04+ GTTGAACTTTCCTCTGCAGATTTCCTTTTAACCACTGTTGATGACAATTCTTCTGCTTTC
JMFS072G09+ GTTGAACTTTCCTCTGCAGATTTCCTTTTAACCACTGTTGATGACAATTCTTCTGCTTTC
JMFS124G02+ ATTGAACTTTCCTCTGCAGATTTCCTTTTAACCACTGTTGATGACAATTCTTCTGCTTTC
JMFS076C04+ GTTGAACTTTCCTCTGCAGATTTCCTTTTAACCACTGTTGATGACAATTCTTCTGCTTTC
                      ____________________________________________________________
consensus GTTGAACTTTCCTCTGCAGATTTCCTTTTAACCACTGTTGATGACAATTCTTCTGCTTTC
 
. : . : . : . : . : . :
JMFS096B05+ ACCTCCATGTGTTTTGCTTAAACCCTCAAGTTCAGAATTTTCGTGAAAGGGAAACAAAGC
JMFS036F11+ ACCTCCATGTGTTTTGCTTAAACCCTCAAGTTCAGAATTTTCGTGAAAGGGAAACAAAGC
JMFS098F02+ ACCTCCATGTGTTTTGCTTAAACCCTCAAGTTCAGAATTTTCGTGAAAGGGAAACAAAGC
JMFS137H04+ ACCTCCATGTGTTTTGCTTAAACCCTCAAGTTCAGAATTTTCGTGAAAGGGAAACAAAGC
JMFS072G09+ ACCTCCATGTGTTTCGCTTAAACCCTCAAGTTCAGAATTTTCGTGAAAGGGAAACAAAGC
JMFS124G02+ ACCTCCATGTGTTTTGCTTAAACCCTCAAGTTCAGAATTTTCGTGAAAGGGAAACAAAGC
JMFS076C04+ ACCTCCATGTGTTTTGCTTAAACCCTCAAGTTCAGAATTTTCGTGAAAGGGAAACAAAGC
                      ____________________________________________________________
consensus ACCTCCATGTGTTTTGCTTAAACCCTCAAGTTCAGAATTTTCGTGAAAGGGAAACAAAGC
 
. : . : . : . : . : . :
JMFS096B05+ CAATGCCAATCAACTACTACTGCCTCCACCAAGCTTATCTCTTCTTTA
JMFS036F11+ CAATGCCAATCAACTACTACTGCCTCCACCAAGCTTATCTCTTCTTTAGGGTTTGCGTAT
JMFS098F02+ CAATGCCAATCAACTACTACTGCCTCCACCAAGCTTATCTCTTCTTTAGGGTTTGCGTAT
JMFS137H04+ CAATGCCAATCAACTACTACTGCCTCCACCAAGCTTATCTCTTCTTTAGGGTTTGCGTAT
JMFS072G09+ CAATGCCAATCAACTACTACTGCCTCCACCAAGCTTATCTCTTCTTTAGGGTTTGCGTAT
JMFS124G02+ CAATGCCAATCAACTACTACTGCCTCCACCAAGCTTATCTCTTCTTTAGGGTTTGCGTAT
JMFS076C04+ CAATGCCAATCAACTACTACTGCCTCCACCAAGCTTATCTCTTCTTTAGGGTTTGCGTAT
                      ____________________________________________________________
consensus CAATGCCAATCAACTACTACTGCCTCCACCAAGCTTATCTCTTCTTTAGGGTTTGCGTAT
 
. : . : . : . : . : . :
JMFS036F11+ AATAGAAAGGAGGAAAACGGCAGGAA
JMFS098F02+ AATAGAAAGGAGGAAAACGGCAGGAAGTGAAGGGGGAGGGGGAGAAA
JMFS137H04+ AATAGAAAGGAGGAAAAAGGCAGGAAGTGAAGGGGGAGGGGGAGAAATAG
JMFS072G09+ AATAGAAAGGAGGAAAACGGCAGGAAGTGAAGGGGGAGGGGGAGAAATAG
JMFS124G02+ AATAGAAAGGAGGAAAACGGCAGGAAGTGAAGGGGGAGGGGGAGAAATAGGGATTTG
JMFS076C04+ AATAGAAAGGAGGAAAACGGCAGGAAGTGAAGGGGGAGGGGGAGAAATAGGGATTTGCAA
                      ____________________________________________________________
consensus AATAGAAAGGAGGAAAACGGCAGGAAGTGAAGGGGGAGGGGGAGAAATAGGGATTTGCAA