Previous Contig 003497:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS008E09Sequence627003497 (3)gb:AY062513_15651694e-20Arabidopsis thaliana Unknown protein (Z97335.29) mRNA, complete cds.>gb:BT002572
JMFS044C10Sequence605003497 (3)gb:AY062513_15651694e-20Arabidopsis thaliana Unknown protein (Z97335.29) mRNA, complete cds.>gb:BT002572
JMFS076B04Sequence627003497 (3)gb:AY062513_15651694e-20Arabidopsis thaliana Unknown protein (Z97335.29) mRNA, complete cds.>gb:BT002572

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS008E09+ TGGTTCATTGAGCCCAATAGAGTCTTTGGATTTTGATCCAAAAGGTGTAGTAGC
JMFS044C10+ GGATTTTGATCCAAAAGGTGTAGTAGC
                      ____________________________________________________________
consensus TGGTTCATTGAGCCCAATAGAGTCTTTGGATTTTGATCCAAAAGGTGTAGTAGC
 
. : . : . : . : . : . :
JMFS008E09+ ATCTAAAGGCTTCACTTCACTTCCCAGCAGTTGAGGATCTCCTAATTGGCTCGTCTTTAA
JMFS044C10+ ATCTAAAGGCTTCACTTCACTTCCCAGCAGTTGAGGATCTCCTAATTGGCTCGTCTTTAA
JMFS076B04+ AGGATCTCCTAATTGGCTCGTCTTTAA
                      ____________________________________________________________
consensus ATCTAAAGGCTTCACTTCACTTCCCAGCAGTTGAGGATCTCCTAATTGGCTCGTCTTTAA
 
. : . : . : . : . : . :
JMFS008E09+ CGGATCATCAAGTGGTTTGGAAGCATCAGTAGGTGCATCAACCTTGGGTAACTCATCGCC
JMFS044C10+ CGGATCATCAAGTGGTTTGGAAGCATCAGTAGGTGCATCAACCTTGGGTAACTCATCGCC
JMFS076B04+ CGGATCATCAAGTGGTTTGGAAGCATCAGTAGGTGCATCAACCTTGGGTAACTCATCGCC
                      ____________________________________________________________
consensus CGGATCATCAAGTGGTTTGGAAGCATCAGTAGGTGCATCAACCTTGGGTAACTCATCGCC
 
. : . : . : . : . : . :
JMFS008E09+ CCCCGGAAATTTTTGAGCATGTTTGCCCAATTTTATAGCAGCCTCCAAACCTTCATCCAT
JMFS044C10+ CCCCGGAAATTTTTGAGCATGTTTGCCCAATTTTATAGCAGCCTCCAAACCTTCATCCAT
JMFS076B04+ CCCCGGAAATTTTTGAGCATGTTTGCCCAATTTTATAGCAGCCTCCAAACCTTCATCCAT
                      ____________________________________________________________
consensus CCCCGGAAATTTTTGAGCATGTTTGCCCAATTTTATAGCAGCCTCCAAACCTTCATCCAT
 
. : . : . : . : . : . :
JMFS008E09+ GACTGGATTATGATGGGCACTATCAGAAAACTCTGTCATGGCATCAGAGAAAAGCTCATC
JMFS044C10+ GACTGGATTATGATGGGCACTATCAGAAAACTCTGTCATGGCATCAGAGAAAAGCTCATC
JMFS076B04+ GACTGGATTATGATGGGCACTATCAGAAAACTCTGTCATGGCATCAGAGAAAAGCTCATC
                      ____________________________________________________________
consensus GACTGGATTATGATGGGCACTATCAGAAAACTCTGTCATGGCATCAGAGAAAAGCTCATC
 
. : . : . : . : . : . :
JMFS008E09+ CTCTGATCTAGTGGATTTGAAGCTAGCAGCAGCCTCTTTCAAACTTTTGTTGTTAACCTT
JMFS044C10+ CTCTGATCTAGTGGATTTGAAGCTAGCAGCAGCCTCTTTCAAACTTTTGTTGTTAACCTT
JMFS076B04+ CTCTGATCTAGTGGATTTGAAGCTAGCAGCAGCCTCTTTCAAACTTTTGTTGTTAACCTT
                      ____________________________________________________________
consensus CTCTGATCTAGTGGATTTGAAGCTAGCAGCAGCCTCTTTCAAACTTTTGTTGTTAACCTT
 
. : . : . : . : . : . :
JMFS008E09+ AGGACTTGGGGTTCGCGGATCATCATCGGAGGGGTGTTCGTCGTCCGAAATAGCCAAATG
JMFS044C10+ AGGACTTGGGGTTCGCGGATCATCATCGGAGGGGTGTTCGTCGTCCGAAATAGCCAAATG
JMFS076B04+ AGGACTTGGGGTTCGCGGATCATCATCGGAGGGGTGTTCGTCGTCCGAAATAGCCAAATG
                      ____________________________________________________________
consensus AGGACTTGGGGTTCGCGGATCATCATCGGAGGGGTGTTCGTCGTCCGAAATAGCCAAATG
 
. : . : . : . : . : . :
JMFS008E09+ GGTGGCTTCAGATTCAGTAAGCTTATACCCCTCAATAGTTCCGCAGACCTTTTTATGGGC
JMFS044C10+ GGTGGCTTCAGATTCAGTAAGCTTATACCCCTCAATAGTTCCGCAGACCTTTTTATGGGC
JMFS076B04+ GGTGGCTTCAGATTCAGTAAGCTTATACCCCTCAATAGTTCCGCAGACCTTTTTATGGGC
                      ____________________________________________________________
consensus GGTGGCTTCAGATTCAGTAAGCTTATACCCCTCAATAGTTCCGCAGACCTTTTTATGGGC
 
. : . : . : . : . : . :
JMFS008E09+ TCTCCTGTGCTTAGCACTCGGGTGCGGGTTTGGGAAAGGCCACCCACATTTGTGACACAA
JMFS044C10+ TCTCCTGTGCTTAGCACTCGGGTGCGGGTTTGGGAAAGGCCACCCACATTTGTGACACAA
JMFS076B04+ TCTCCTGTGCTTAGCACTCGGGTGCGGGTTTGGGAAAGGCCACCCACATTTGTGACACAA
                      ____________________________________________________________
consensus TCTCCTGTGCTTAGCACTCGGGTGCGGGTTTGGGAAAGGCCACCCACATTTGTGACACAA
 
. : . : . : . : . : . :
JMFS008E09+ GTGCACGCCATGGCTCGCATGACCTGACGACACCGTTGCTTTGTGATCTTGGTTCTCCAT
JMFS044C10+ GTGCACGCCATGGCTCGCATGACCTGACGACACCGTTGCTTTGTGATCTTGGTTCTCCAT
JMFS076B04+ GTGCACGCCATGGCTCGCATGACCTGACGACACCGTTGCTTTGTGATCTTGGTTCTCCAT
                      ____________________________________________________________
consensus GTGCACGCCATGGCTCGCATGACCTGACGACACCGTTGCTTTGTGATCTTGGTTCTCCAT
 
. : . : . : . : . : . :
JMFS008E09+ TTTTCACGAATACAGAGAGAAGAAGACAAGGAG
JMFS044C10+ TTTTCACGAATACAGAGAGAAGAAGACAAGGAG
JMFS076B04+ TTTTCACGAATACAGAGAGAAGAAGACAAGGAGAGCTGGAACACTGGAACAGGGAAAGAG
                      ____________________________________________________________
consensus TTTTCACGAATACAGAGAGAAGAAGACAAGGAGAGCTGGAACACTGGAACAGGGAAAGAG
 
. : . : . : . : . : . :
JMFS076B04+ AGAGAGAGACAGTGTGAAAATGCGGAGTGTTTGGAATGCAAAATAGAAAAATATTTTGGC
                      ____________________________________________________________
consensus AGAGAGAGACAGTGTGAAAATGCGGAGTGTTTGGAATGCAAAATAGAAAAATATTTTGGC