Previous Contig 003491:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS043H09Sequence601003491 (4)gb:AP001307_18211064e-12Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MMM17.
JMFS072D10Sequence627003491 (4)gb:AP001307_18211061e-51Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MMM17.
JMFS074G12Sequence670003491 (4)gb:BT000971_16352263e-29Arabidopsis thaliana clone C104780 unknown protein (At5g56790) mRNA, complete cd
JMFS166H05Sequence627003491 (4)gb:BT000971_16352262e-33Arabidopsis thaliana clone C104780 unknown protein (At5g56790) mRNA, complete cd

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS072D10+ TCACATTCGGTACCCGAATATGATT
                      ____________________________________________________________
consensus TCACATTCGGTACCCGAATATGATT
 
. : . : . : . : . : . :
JMFS072D10+ GCAGGTACCAGAGCTTTCAGCCACACTTTTCCTGGATATTTGTGATCCAGAGATAATCTC
                      ____________________________________________________________
consensus GCAGGTACCAGAGCTTTCAGCCACACTTTTCCTGGATATTTGTGATCCAGAGATAATCTC
 
. : . : . : . : . : . :
JMFS072D10+ AGCATCAGTGCTCGGTGATCCAATGAAATTCAAACGAAGCACCTTTGGACGAGACTTTTT
                      ____________________________________________________________
consensus AGCATCAGTGCTCGGTGATCCAATGAAATTCAAACGAAGCACCTTTGGACGAGACTTTTT
 
. : . : . : . : . : . :
JMFS072D10+ CATCATAACTACATTGCATTCCAGTTCCTGCATGCAACTTTTCGCCTCTTTTTTCATTCT
                      ____________________________________________________________
consensus CATCATAACTACATTGCATTCCAGTTCCTGCATGCAACTTTTCGCCTCTTTTTTCATTCT
 
. : . : . : . : . : . :
JMFS072D10+ CTTGTCCAACACCACCCAATGAACTTGAGTTTTTTTGGCTTCAGCAGCTACTACCCCATA
JMFS166H05+ TTTTTTGGCTTCAGCAGCTACTACCCCATA
JMFS074G12+ CTACCCCATA
                      ____________________________________________________________
consensus CTTGTCCAACACCACCCAATGAACTTGAGTTTTTTTGGCTTCAGCAGCTACTACCCCATA
 
. : . : . : . : . : . :
JMFS072D10+ GTCTAATCCAGAAACGACTTTAATCTTCATTCTTATTTTATCTGGATCAAAAAGATTACT
JMFS166H05+ GTCTAATCCAGAAACGACTTTAATCTTCATTCTTATTTTATCTGGATCAAAAAGATTACT
JMFS074G12+ GTCTAATCCAGAAACGACTTTAATCTTCATTCTTATNTTATCTGGATCAAAAAGATTACT
                      ____________________________________________________________
consensus GTCTAATCCAGAAACGACTTTAATCTTCATTCTTATTTTATCTGGATCAAAAAGATTACT
 
. : . : . : . : . : . :
JMFS072D10+ AAGTTGAAGCATTATTTGGGTGCATGAATCTGTAATGTAATCCTTCTGATCTAGACGTGT
JMFS166H05+ AAGTTGAAGCATTATTTGGGTGCATGAATCTGTAATGTAATCCTTCTGATCTAGACGTGT
JMFS074G12+ AAGTTGAAGCATTATTTGGGTGCATGAATCTGTAATGTAATCCTTCTGATCTAGACGTGT
                      ____________________________________________________________
consensus AAGTTGAAGCATTATTTGGGTGCATGAATCTGTAATGTAATCCTTCTGATCTAGACGTGT
 
. : . : . : . : . : . :
JMFS072D10+ TCCAGAGAATGATTTCCAGTGAGCAGCCGTGCAATCACTCCCAAATCTTTGGAAACCCCA
JMFS166H05+ TCCAGAGAATGATTTCCAGTGAGCAGCCGTGCAATCACTCCCAAATCTTTGGAAACCCCA
JMFS074G12+ TCCAGAGAATGATTTCCAGTGAGCAGCCGTGCAATCACTCCCAAATCTTTGGAAACCCCA
                      ____________________________________________________________
consensus TCCAGAGAATGATTTCCAGTGAGCAGCCGTGCAATCACTCCCAAATCTTTGGAAACCCCA
 
. : . : . : . : . : . :
JMFS072D10+ TAGTCTTTTACTTGAAGAACTATGATTTGGAATGACCACCAAAAGCTTCACACAATCTCC
JMFS166H05+ TAGTCTTTTACTTGAAGAACTATGATTTGGAATGACCACCAAAAGCTTCACACAATCTCC
JMFS043H09+ TACTTGAAGAACTATGATTTGGAATGACCACCAAAAGCTTCACACAATCTCC
JMFS074G12+ TAGTCTTTTACTTGAAGAACTATGATTTGGAATGACCACCAAAAGCTTCACACAATCTCC
                      ____________________________________________________________
consensus TAGTCTTTTACTTGAAGAACTATGATTTGGAATGACCACCAAAAGCTTCACACAATCTCC
 
. : . : . : . : . : . :
JMFS072D10+ AGGCTGAACAACATGAGTGAGAGCCCAAATCAGAGCAGCTCTTGGGATATCTTTGGAGAC
JMFS166H05+ AGGCTGAACAACATGAGTGAGAGCCCAAATCAGAGCAGCTCTTGGGATATCTTTGGAGAC
JMFS043H09+ AGGCTGAACAACATGAGTGAGAGCCCAAATCAGAGCAGCTCTTGGGATATCTTTGGAGAC
JMFS074G12+ AGGCTGAACAACATGAGTGAGAGCCCAAATCAGAGCAGCTCTTGGGATATCTTTGGAGAC
                      ____________________________________________________________
consensus AGGCTGAACAACATGAGTGAGAGCCCAAATCAGAGCAGCTCTTGGGATATCTTTGGAGAC
 
. : . : . : . : . : . :
JMFS072D10+ TTTAACAGCAACAAGCACAAGCCTCTTTCCCGCATCCAAACTCCTATCTTTCCCACTCTT
JMFS166H05+ TTTAACAGCAACAAGCACAAGCCTCTTTCCCGCATCCAAACTCCTATCTTTCCCACTCTT
JMFS043H09+ TTTAACAGCAACAAGCACAAGCCTCTTTCCCGCATCCAAACTCCTATCTTTCCCACTCTT
JMFS074G12+ TTTAACAGCAACAAGCACAAGCCTCTTTCCCGCATCCAAACTCCTATCTTTCCCACTCTT
                      ____________________________________________________________
consensus TTTAACAGCAACAAGCACAAGCCTCTTTCCCGCATCCAAACTCCTATCTTTCCCACTCTT
 
. : . : . : . : . : . :
JMFS072D10+ TT
JMFS166H05+ TTGTCTCATATTCATCTTAACTCTCAAGCCACCCAACAGACAATCTGCCACCTCTCAAAT
JMFS043H09+ TTGTCTCATATTCATCTTAACTCTCAAGCCACCCAACAGACAATCTGCCACCTCTCAAAT
JMFS074G12+ TTGTCTCATATTCATCTTAACTCTCAAGCCACCCAACAGACAATCTGCCACCTCTCAAAT
                      ____________________________________________________________
consensus TTGTCTCATATTCATCTTAACTCTCAAGCCACCCAACAGACAATCTGCCACCTCTCAAAT
 
. : . : . : . : . : . :
JMFS166H05+ CAGCACTGTGAATTCATCAAACACCTTGTACCCATTTCGCCAAACTTCATTTTCTTTGCC
JMFS043H09+ CAGCACTGTGAATTCATCAAACACCTTGTACCCATTTCGCCAAACTTCATTTTCTTTGCC
JMFS074G12+ CAGCACTGTGAATTCATCAAACACCTTGTACCCATTTCGCCAAACTTCATTTTCTTTGCC
                      ____________________________________________________________
consensus CAGCACTGTGAATTCATCAAACACCTTGTACCCATTTCGCCAAACTTCATTTTCTTTGCC
 
. : . : . : . : . : . :
JMFS166H05+ ACCCCATCAACAACAAAAGAAAAAGTCTTCACCTTTTGACCTCCTCGTTGAAGAAAAGCT
JMFS043H09+ ACCCCATCAACAACAAAAGAAAAAGTCTTCACCTTTTGACCTCCTCGTTGAAGAAAAGCT
JMFS074G12+ ACCCCATCAACAACAAAAGAAAAAGTCTTCACCTTTTGACCTCCTCGTTGAAGAAAAGCT
                      ____________________________________________________________
consensus ACCCCATCAACAACAAAAGAAAAAGTCTTCACCTTTTGACCTCCTCGTTGAAGAAAAGCT
 
. : . : . : . : . : . :
JMFS166H05+ CAGAAATGTCCAAACAGCTACAATGGTTGAGAACTAACCATTGATTTCAAAGTAA
JMFS043H09+ CAGAAATGTCCAAACAGCTACAATGGTTGAGAACTAACCATTGATTTCAAAGTAATTTCC
JMFS074G12+ CAGAAATGTCCAAACAGCTACAATGGTTGAGAACTAACCATTGATTTCAAAGTAATTTCC
                      ____________________________________________________________
consensus CAGAAATGTCCAAACAGCTACAATGGTTGAGAACTAACCATTGATTTCAAAGTAATTTCC
 
. : . : . : . : . : . :
JMFS043H09+ ACTAAAGGCAGACTAAAAGT
JMFS074G12+ ACTAAAGGCAGACTAAAAGTCTAAAACATTGCGATCAAGATTGGGATTTGCACAGTTCAT
                      ____________________________________________________________
consensus ACTAAAGGCAGACTAAAAGTCTAAAACATTGCGATCAAGATTGGGATTTGCACAGTTCAT