Previous Contig 003484:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF048H18Sequence489003484 (7)gb:AB025613_15163612e-07Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K2I5.>gb:BT000441_1634431010818 (2)gb:OSJN00294_16980976e-06Oryza sativa genomic DNA, chromosome 4, BAC clone: B1160F02, complete sequence.
JMFS074B03Sequence627003484 (7)gb:AB025613_15163614e-09Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K2I5.>gb:BT000441_1634
JMFS096G12Sequence609003484 (7)gb:AB025613_15163613e-09Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K2I5.>gb:BT000441_1634
JMFS124E02Sequence576003484 (7)gb:AB025613_15163613e-07Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K2I5.>gb:BT000441_1634
JMFS126C03Sequence581003484 (7)gb:AB025613_15163612e-14Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K2I5.>gb:BT000441_1634
JMFS149G03Sequence626003484 (7)gb:AB025613_15163613e-11Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K2I5.>gb:BT000441_1634
JMSF018O11Sequence454003484 (7)gb:AB025613_15163613e-12Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K2I5.>gb:BT000441_1634734010818 (2)gb:AB025613_15163619e-56Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K2I5.>gb:BT000441_1634

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS126C03+ TCACACTCTGCATACAAACNCCGCAGCTATTCCTGGAAAGACGGAGGGTGTTCTTG
                      ____________________________________________________________
consensus TCACACTCTGCATACAAACNCCGCAGCTATTCCTGGAAAGACGGAGGGTGTTCTTG
 
. : . : . : . : . : . :
JMFS126C03+ AGGATTGAAAAGGGGGAATCTGGGCGACGCAGGGTTAGAAGCAAGGCGAGTTCTGGGAGT
                      ____________________________________________________________
consensus AGGATTGAAAAGGGGGAATCTGGGCGACGCAGGGTTAGAAGCAAGGCGAGTTCTGGGAGT
 
. : . : . : . : . : . :
JMSF018O11+ GGAAGAATTAGATTTCGGGGTGGTGGTTTTGCAATGGAGGCTTGGGCTGACGAGATT
JMFS126C03+ CTTGGAAGAATTAGATTTCGGGGTGGTGGTTTTGCAATGGAGGCTTGGGCTGACGAGATT
JMFS149G03+ GGGCTGACGAGATT
                      ____________________________________________________________
consensus CTTGGAAGAATTAGATTTCGGGGTGGTGGTTTTGCAATGGAGGCTTGGGCTGACGAGATT
 
. : . : . : . : . : . :
JMSF018O11+ ATCACTGTTTTCATTCGAAGCCGCGGCGGTTCTGCAACGCAGACGAGGCGTAGTAGAAGC
JMFS126C03+ ATCACTGTTTTCATTCGAAGCCGCGGCGGTTCTGCAACGCAGACGAGGCGTAGTAGAAGC
JMFS149G03+ ATCACTGTTTTCATTCGAAGCCGCGGCGGTTCTGCAACGCAGACGAGGCGTAGTAGAAGC
JMFS096G12+ GCAACGCAGACGAGGCGTAGTAGAAGC
JMFF048H18+ TAGTAGAAGC
JMFS124E02+ CGAGGCGTAGTAGAAGC
JMFS074B03+ GCAACGCAGACGAGGCGTAGTAGAAGC
                      ____________________________________________________________
consensus ATCACTGTTTTCATTCGAAGCCGCGGCGGTTCTGCAACGCAGACGAGGCGTAGTAGAAGC
 
. : . : . : . : . : . :
JMSF018O11+ GCTGCTGCTACCACTTTTACTGTTATTATTCAAAAAACCCAGTTTTGCACAGCTTCTTGG
JMFS126C03+ GCTGCTGCTACCACTTTTACTGTTATTATTCAAAAAACCCAGTTTTGCACAGCTTCTTGG
JMFS149G03+ GCTGCTGCTACCACTTTTACTGTTATTATTCAAAAAACCCAGTTTTGCACAGCTTCTTGG
JMFS096G12+ GCTGCTGCTACCACTTTTACTGTTATTATTCAAAAAACCCAGTTTTGCACAGCTTCTTGG
JMFF048H18+ GCTGCTGCTACCACTTTTACTGTTATTATTCAAAAAACCCAGTTTTGCACAGCTTCTTGG
JMFS124E02+ GCTGCTGCTACCACTTTTACTGTTATTATTCAAAAAACCCAGTTTTGCACAGCTTCTTGG
JMFS074B03+ GCTGCTGCTACCACTTTTACTGTTATTATTCAAAAAACCCAGTTTTGCACAGCTTCTTGG
                      ____________________________________________________________
consensus GCTGCTGCTACCACTTTTACTGTTATTATTCAAAAAACCCAGTTTTGCACAGCTTCTTGG
 
. : . : . : . : . : . :
JMSF018O11+ ACTGGGACTAGGGCTCGATTGTGTGTGTTCATGATCTTGATAAAGATGTTTATCAACGAA
JMFS126C03+ ACTGGGACTAGGGCTCGATTGTGTGTGTTCATGATCTTGATAAAGATGTTTATCAACGAA
JMFS149G03+ ACTGGGACTAGGGCTCGATTGTGTGTGTTCATGATCTTGATAAAGATGTTTATCAACGAA
JMFS096G12+ ACTGGGACTAGGGCTCGATTGTGTGTGTTCATGATCTTGATAAAGATGTTTATCAACGAA
JMFF048H18+ ACTGGGACTAGGGCTCGATTGTGTGTGTTCATGATCTTGATAAAGATGTTTATCAACGAA
JMFS124E02+ ACTGGGACTAGGGCTCGATTGTGTGTGTTCATGATCTTGATAAAGATGTTTATCAACGAA
JMFS074B03+ ACTGGGACTAGGGCTCGATTGTGTGTGTTCATGATCTTGATAAAGATGTTTATCAACGAA
                      ____________________________________________________________
consensus ACTGGGACTAGGGCTCGATTGTGTGTGTTCATGATCTTGATAAAGATGTTTATCAACGAA
 
. : . : . : . : . : . :
JMSF018O11+ TTTGGGTTCTCTATCTCGTGGGATAGTAGTGCAGAAAGCCCTTCTCCAACCAGTCCCCAT
JMFS126C03+ TTTGGGTTCTCTATCTCGTGGGATAGTAGTGCAGAAAGCCCTTCTCCAACCAGTCCCCAT
JMFS149G03+ TTTGGGTTCTCTATCTCGTGGGATAGTAGTGCAGAAAGCCCTTCTCCAACCAGTCCCCAT
JMFS096G12+ TTTGGGTTCTCTATCTCGTGGGATAGTAGTGCAGAAAGCCCTTCTCCAACCAGTCCCCAT
JMFF048H18+ TTTGGGTTCTCTATCTCGTGGGATAGTAGTGCAGAAAGCCCTTCTCCAACCAGTCCCCAT
JMFS124E02+ TTTGGGTTCTCTATCTCGTGGGATAGTAGTGCAGAAAGCCCTTCTCCAACCAGTCCCCAT
JMFS074B03+ TTTGGGTTCTCTATCTCGTGGGATAGTAGTGCAGAAAGCCCTTCTCCAACCAGTCCCCAT
                      ____________________________________________________________
consensus TTTGGGTTCTCTATCTCGTGGGATAGTAGTGCAGAAAGCCCTTCTCCAACCAGTCCCCAT
 
. : . : . : . : . : . :
JMSF018O11+ TTCTCAACAAACAAACCAAAAAAAGAACGATCTTTATGATTATACAAGAGGAAAAGGAGG
JMFS126C03+ TTCTCAACAAACAAACCAAAAAAAGAACGATCTTTATGATTATACAAGAGGAAAAGGAGG
JMFS149G03+ TTCTCAACAAACAAACCAAAAAAAGAACGATCTTTATGATTATACAAGAGGAAAAGGAGG
JMFS096G12+ TTCTCAACAAACAAACCAAAAAAAGAACGATCTTTATGATTATACAAGAGGAAAAGGAGG
JMFF048H18+ TTCTCAACAAACAAACCAAAAAAAGAACGATCTTTATGATTATACAAGAGGAAAAGGAGG
JMFS124E02+ TTCTCAACAAACAAACCAAAAAAAGAACGATCTTTATGATTATACAAGAGGAAAAGGAGG
JMFS074B03+ TTCTCAACAAACAAACCAAAAAAAGAACGATCTTTATGATTATACAAGAGGAAAAGGAGG
                      ____________________________________________________________
consensus TTCTCAACAAACAAACCAAAAAAAGAACGATCTTTATGATTATACAAGAGGAAAAGGAGG
 
. : . : . : . : . : . :
JMSF018O11+ ATTGCAGGGATGGATCTGAGGAAGGTGACAGAGAAGACAAAATGGTAAGAGTTTGGAAGA
JMFS126C03+ ATTGCAGGGATGGATCTGAGGAAGGTGACAGAGAAGACAAAATGGTAAGAGTTTGGAAGA
JMFS149G03+ ATTGCAGGGATGGATCTGAGGAAGGTGACAGAGAAGACAAAATGGTAAGAGTTTGGAAGA
JMFS096G12+ ATTGCAGGGATGGATCTGAGGAAGGTGACAGAGAAGACAAAATGGTAAGAGTTTGGAAGA
JMFF048H18+ ATTGCAGGGATGGATCTGAGGAAGGTGACAGAGAAGACAAAATGGTAAGAGTTTGGAAGA
JMFS124E02+ AT---AGGGATGGATCTGAGGAAGGTGACAGAGAAGACAAAATGGTAAGAGTTTGGAAGA
JMFS074B03+ ATTGCAGGGATGGATCTGAGGAAGGTGACAGAGAAGACAAAATGGTAAGAGTTTGGAAGA
                      ____________________________________________________________
consensus ATTGCAGGGATGGATCTGAGGAAGGTGACAGAGAAGACAAAATGGTAAGAGTTTGGAAGA
 
. : . : . : . : . : . :
JMSF018O11+ AGAAGAAGAAGATGATGATAAAGAGGATGAGAGTAT
JMFS126C03+ AGAAGAAGAAGATGATGATAAAGAGGATGAGAGTATGGGATCAAA
JMFS149G03+ AGAAGAAGAAGATGATGATAAAGAGGATGAGAGTATGGGATCAAATGAAAGATGAGAGGA
JMFS096G12+ AGAAGAAGAAGATGATGATAAAGAGGATGAGAGTATGGGATCAAATGAAAGATGAGAGGA
JMFF048H18+ AGAAGAAGAAGATGATGATAAAGAGGATGAGAGTATGGGATCAAATGAAAGATGAGAGGA
JMFS124E02+ AGAAGAAGAAGATGATGATAAAGAGGATGAGAGTATGGGATCAAATGAAAGATGAGAGGA
JMFS074B03+ AGAAGAAGAAGATGATGATAAAGAGGATGAGAGTATGGGATCAAATGAAAGATGAGAGGA
                      ____________________________________________________________
consensus AGAAGAAGAAGATGATGATAAAGAGGATGAGAGTATGGGATCAAATGAAAGATGAGAGGA
 
. : . : . : . : . : . :
JMFS149G03+ TGGAATATAAATGGCAGTAGAGACAAACGACAGGGGATTAAAGATAGAGTAATCCCAGCT
JMFS096G12+ TGGAATATAAATGGCAGTAGAGACAAACGACAGGGGATTAAAGATAGAGTAATCCCAGCT
JMFF048H18+ TGGAATATAAATGGCAGTAGAGACAAACGACAGGGGATTAAAGATAGAGTAATCCCAGCT
JMFS124E02+ TGGAATATAAATGGCAGTAGAGACAAACGACAGGGGATTAAAGATAGAGTAATCCCAGCT
JMFS074B03+ TGGAATATAAATGGCAGTAGAGACAAACGACAGGGGATTAAAGATAGAGTAATCCCAGCT
                      ____________________________________________________________
consensus TGGAATATAAATGGCAGTAGAGACAAACGACAGGGGATTAAAGATAGAGTAATCCCAGCT
 
. : . : . : . : . : . :
JMFS149G03+ CAGAGTCAGAGGCTCAATTTCTTGCTTTCTTTCTCTGGTCCCTG
JMFS096G12+ CAGAGTCAGAGGCTCAATTTCTTGCTTTCTTTCTCTGGTCCCTG
JMFF048H18+ CAGAGTCAGAGGCTCAATTTCTTGCTTTCTTTCTCTGGTCCCTG
JMFS124E02+ CAGAGTCAGAGGCTCAATTTCTTGCTTTCTTTCTCTGGTCCCTG
JMFS074B03+ CAGAGTCAGAGGCTCAATTTCTTGCTTTCTTTCTCTGGTCCCTGXXXXXXXXXXXXXXXX
                      ____________________________________________________________
consensus CAGAGTCAGAGGCTCAATTTCTTGCTTTCTTTCTCTGGTCCCTGNNNNNNNNNNNNNNNN
 
. : . : . : . : . : . :
JMFS074B03+ XXXXXXXXXXXXXXXXXXXXXXXXGTTTGTATGTATTGATCACCAGACCCAAAAAGGCCG
                      ____________________________________________________________
consensus NNNNNNNNNNNNNNNNNNNNNNNNGTTTGTATGTATTGATCACCAGACCCAAAAAGGCCG
 
. : . : . : . : . : . :
JMFS074B03+ CTGCATCTAAAGGAAGGATTGAGATCTGCTTCTTTCTACTTCTCTCTCCCTTGGTATCAT
                      ____________________________________________________________
consensus CTGCATCTAAAGGAAGGATTGAGATCTGCTTCTTTCTACTTCTCTCTCCCTTGGTATCAT