Previous Contig 003483:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS074A02Sequence643003483 (2)
JMSF023P14Sequence639003483 (2)gb:AY136301_15818029e-13Arabidopsis thaliana putative protein (At5g11390) mRNA, complete cds.>gb:BT00039

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF023P14+ ACTCTCGGCATCATTCAACTTTTC
                      ____________________________________________________________
consensus ACTCTCGGCATCATTCAACTTTTC
 
. : . : . : . : . : . :
JMSF023P14+ TTCAATCACCCCATAAAGTTCTCCTGCATCCTCACATGAAGGTATGATCTGGCGGGAATA
                      ____________________________________________________________
consensus TTCAATCACCCCATAAAGTTCTCCTGCATCCTCACATGAAGGTATGATCTGGCGGGAATA
 
. : . : . : . : . : . :
JMSF023P14+ CCCAATCTCCATTTGAAGAGAGGACAACAAAACACTTAGTTCCCTTACCTCAGAGTCCAA
                      ____________________________________________________________
consensus CCCAATCTCCATTTGAAGAGAGGACAACAAAACACTTAGTTCCCTTACCTCAGAGTCCAA
 
. : . : . : . : . : . :
JMSF023P14+ GAGTACAGATAAAAGCTCAAACTCCATCGCCTTCTGAACAGAATCATTTGAACTTTGCTC
                      ____________________________________________________________
consensus GAGTACAGATAAAAGCTCAAACTCCATCGCCTTCTGAACAGAATCATTTGAACTTTGCTC
 
. : . : . : . : . : . :
JMSF023P14+ CTTCTCAGCAACAAAAGCCTCAAATTCATTTTCCCTTGTTTCCACATGCATTTTAAGTAC
                      ____________________________________________________________
consensus CTTCTCAGCAACAAAAGCCTCAAATTCATTTTCCCTTGTTTCCACATGCATTTTAAGTAC
 
. : . : . : . : . : . :
JMSF023P14+ ACCTAAATTGGCAAGTTTCTCTGAGGAGCCTGCTAAATCTACTTCAATCTTAGCAATAAC
                      ____________________________________________________________
consensus ACCTAAATTGGCAAGTTTCTCTGAGGAGCCTGCTAAATCTACTTCAATCTTAGCAATAAC
 
. : . : . : . : . : . :
JMSF023P14+ CTCCTCCTCAATACTTCCTAGTTCTTGCATGGTTTCTCCACTAGATACAATCACATCAAG
JMFS074A02+ CTAGTTCTTGCATGGTTTCTCCACTAGATACAATCACATCAAG
                      ____________________________________________________________
consensus CTCCTCCTCAATACTTCCTAGTTCTTGCATGGTTTCTCCACTAGATACAATCACATCAAG
 
. : . : . : . : . : . :
JMSF023P14+ AGAGTCAACATTCTTCGATTCTTCCTCCAGTTCACCAGAGCAGTGTTCATCCTTCCCAGA
JMFS074A02+ AGAGTCAACATTCTTCGATTCTTCCTCCAGTTCACCAGAGCAGTGTTCATCCTTCCCAGA
                      ____________________________________________________________
consensus AGAGTCAACATTCTTCGATTCTTCCTCCAGTTCACCAGAGCAGTGTTCATCCTTCCCAGA
 
. : . : . : . : . : . :
JMSF023P14+ GTTGGCATCCATGATAGTTTTTGAGCTACAGACAGACGATCCTTAACAGTCCACAAATCC
JMFS074A02+ GTTGGCATCCATGATAGTTTTTGAGCTACAGACAGACGATCCTTAACAGTCCACAAATCC
                      ____________________________________________________________
consensus GTTGGCATCCATGATAGTTTTTGAGCTACAGACAGACGATCCTTAACAGTCCACAAATCC
 
. : . : . : . : . : . :
JMSF023P14+ TGACAACTCCGTAAAGGTTATTCACCCAGGCTCAGGAGACT
JMFS074A02+ TGACAACTCCGTAAAGGTTATTCACCCAGGCTCAGGAGACTACATTTAAAAAGGTCCACA
                      ____________________________________________________________
consensus TGACAACTCCGTAAAGGTTATTCACCCAGGCTCAGGAGACTACATTTAAAAAGGTCCACA
 
. : . : . : . : . : . :
JMFS074A02+ CATCACGGGGCTATATTGCATGTCAGAAGTTCCAACAGCACACAAGTAGGATATGCATTT
                      ____________________________________________________________
consensus CATCACGGGGCTATATTGCATGTCAGAAGTTCCAACAGCACACAAGTAGGATATGCATTT
 
. : . : . : . : . : . :
JMFS074A02+ TCCAGAACATAGAACGAATCACAGAAAGGCTAAAAATGCATCCAGAAAGATCATGGATTG
                      ____________________________________________________________
consensus TCCAGAACATAGAACGAATCACAGAAAGGCTAAAAATGCATCCAGAAAGATCATGGATTG
 
. : . : . : . : . : . :
JMFS074A02+ ATAAATGTCAGGATCAAGCGTTTATCACTATACCAATAGCTATAGTTAATAGTGAAAGCG
                      ____________________________________________________________
consensus ATAAATGTCAGGATCAAGCGTTTATCACTATACCAATAGCTATAGTTAATAGTGAAAGCG
 
. : . : . : . : . : . :
JMFS074A02+ CAACTTTATTTCCTTATACTTGCGTAGCAGTCGGTGTCATGTTTCAATGGCAGGATGCTG
                      ____________________________________________________________
consensus CAACTTTATTTCCTTATACTTGCGTAGCAGTCGGTGTCATGTTTCAATGGCAGGATGCTG
 
. : . : . : . : . : . :
JMFS074A02+ GACTCGGCTCTCTGAGCCACCCCAATAGCTATAGTTAGTAGTAAAAGCGCAACTTTATTT
                      ____________________________________________________________
consensus GACTCGGCTCTCTGAGCCACCCCAATAGCTATAGTTAGTAGTAAAAGCGCAACTTTATTT
 
. : . : . : . : . : . :
JMFS074A02+ CCTTATACTTGCGTAGTAGCAGTCAGTGCCATGTTTCGACGACAGAATGCTGGACTCGGC
                      ____________________________________________________________
consensus CCTTATACTTGCGTAGTAGCAGTCAGTGCCATGTTTCGACGACAGAATGCTGGACTCGGC
 
. : . : . : . : . : . :
JMFS074A02+ TCTCTGTTGGAAGAGTAGAAGAGCTGAGAGTGAGTCTGAACTGCTGAACTTCGTTTCGGC
                      ____________________________________________________________
consensus TCTCTGTTGGAAGAGTAGAAGAGCTGAGAGTGAGTCTGAACTGCTGAACTTCGTTTCGGC