Previous Contig 003481:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004A01Sequence267003481 (46)gb:AP004778_18449436e-20Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P045649004614 (55)gb:AF230372_17790382e-84Lycopersicon esculentum fatty acid hydroperoxide lyase (HPL) mRNA, complete cds.
JMFF038C12Sequence316003481 (46)gb:AP005527_18535277e-20Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060
JMFF042C12Sequence648003481 (46)gb:AP005527_18535272e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060594012486 (3)gb:AP004464_18414434e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P066
JMFF046L08Sequence530003481 (46)gb:AP005527_18535271e-19Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060499010668 (39)gb:AB049723_15209122e-32Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd
JMFF048F17Sequence398003481 (46)gb:AP005527_18535277e-20Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060294010668 (39)
JMFF051J20Sequence576003481 (46)gb:AP005527_18535271e-19Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060494010668 (39)gb:AB049723_15209129e-42Pisum sativum ssa-13 mRNA for putative senescence-associated protein, partial cd
JMFN006P22Sequence335003481 (46)gb:APU12823_12855212e-05Acanthamoeba polyphaga CDC:0187:1 hemolysin mRNA, complete cds.
JMFS005C11Sequence527003481 (46)gb:AP005527_18535272e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060
JMFS005F05Sequence542003481 (46)gb:CR382124_16570991e-09Kluyveromyces lactis strain NRRL Y-1140 chromosome D of strain NRRL Y-1140 of Kl
JMFS017B10Sequence627003481 (46)gb:AP005527_18535272e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060
JMFS024B05Sequence604003481 (46)gb:AP005527_18535271e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060
JMFS034E01Sequence603003481 (46)gb:AP005527_18535272e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060
JMFS036H08Sequence499003481 (46)gb:AP005527_18535271e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060
JMFS037B03Sequence609003481 (46)gb:AP005527_18535272e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060
JMFS038A09Sequence600003481 (46)gb:AP005527_18535278e-18Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060
JMFS042H02Sequence605003481 (46)gb:CR382124_16570991e-11Kluyveromyces lactis strain NRRL Y-1140 chromosome D of strain NRRL Y-1140 of Kl
JMFS043G07Sequence624003481 (46)gb:AP005527_18535273e-18Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060
JMFS049A05Sequence618003481 (46)gb:AP005527_18535272e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060
JMFS054D05Sequence616003481 (46)gb:AP005527_18535272e-16Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060
JMFS061H12Sequence612003481 (46)gb:AP004778_18449432e-21Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P045
JMFS065C11Sequence627003481 (46)gb:AP005527_18535272e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060
JMFS065F02Sequence595003481 (46)gb:AP005527_18535272e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060
JMFS066C10Sequence627003481 (46)gb:AP005527_18535272e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060
JMFS070E01Sequence625003481 (46)gb:AP005527_18535272e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060
JMFS073H02Sequence642003481 (46)gb:AP004778_18449432e-21Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P045
JMFS077A05Sequence625003481 (46)gb:AP005527_18535272e-18Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060
JMFS078E05Sequence627003481 (46)gb:AP004778_18449434e-22Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P045
JMFS081G07Sequence627003481 (46)gb:AP005527_18535272e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060
JMFS085B07Sequence601003481 (46)gb:AP005527_18535271e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060
JMFS088B09Sequence627003481 (46)gb:AP005527_18535272e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060
JMFS092E08Sequence599003481 (46)gb:AP005527_18535272e-09Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060
JMFS094B09Sequence625003481 (46)gb:AP005527_18535272e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060
JMFS094D10Sequence623003481 (46)gb:AP005527_18535273e-21Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060
JMFS099F01Sequence598003481 (46)gb:AP005527_18535272e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060
JMFS101E10Sequence618003481 (46)gb:AP005527_18535279e-18Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060
JMFS101G07Sequence430003481 (46)gb:AP004778_18449432e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P045
JMFS111G09Sequence618003481 (46)gb:AP005527_18535272e-19Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060
JMFS116G08Sequence560003481 (46)gb:AP005527_18535272e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060
JMFS139H10Sequence612003481 (46)gb:AP005527_18535279e-18Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060
JMFS144D07Sequence608003481 (46)gb:AP005527_18535272e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060
JMFS144H08Sequence496003481 (46)gb:AP005527_18535271e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060
JMFS150H01Sequence515003481 (46)gb:AP005527_18535271e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060
JMFS153B04Sequence612003481 (46)gb:AP005527_18535271e-19Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P060
JMFS165D04Sequence567003481 (46)gb:CR382124_16570992e-09Kluyveromyces lactis strain NRRL Y-1140 chromosome D of strain NRRL Y-1140 of Kl
JMSF041K19Sequence834007432 (2)pir|T10548|T105481e-14hypothetical protein T12G13.50 - Arabidopsis thaliana>gb:ATCHRIV22_1544537 Arabi681003481 (46)
JMSF041P11Sequence745007432 (2)pir|T04548|T045484e-07hypothetical protein F28J12.180 - Arabidopsis thaliana>gb:AX544455_1470135 Seque710003481 (46)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF041K19- GAAGTTTCCTTAGTACACAAATAATGAACCTTCAA
rJMSF041P11- TTTCCTTAGTACACAAATAATGAACCTTCAA
                      ____________________________________________________________
consensus GAAGTTTCCTTAGTACACAAATAATGAACCTTCAA
 
. : . : . : . : . : . :
rJMSF041K19- AAAATGAACATTCAATGTATTTAAAATTGTACTTTATGTCAGTGATTGGCCTTACAAGGG
rJMSF041P11- AAAATGAACATTCAATGTATTTAAAATTGTACTTTATGTCAGTGATTGGCCTTACAAGGG
                      ____________________________________________________________
consensus AAAATGAACATTCAATGTATTTAAAATTGTACTTTATGTCAGTGATTGGCCTTACAAGGG
 
. : . : . : . : . : . :
rJMSF041K19- GGCAGGGGTCGGTCCATGGTATAACGATTGGTTACGTATGAATCCAAGGAACAAATAGTG
rJMSF041P11- GGCAGGGGTCGGTCCATGGTATAACGATTGGTTACGTATGAATCCAAGGAACAAATAGTG
                      ____________________________________________________________
consensus GGCAGGGGTCGGTCCATGGTATAACGATTGGTTACGTATGAATCCAAGGAACAAATAGTG
 
. : . : . : . : . : . :
rJMSF041K19- CGCTGAACACCAAAGGCAGGCAGGCATCCCAATTAATGAAAACTGTCTTTACATCCTCTC
rJMSF041P11- CGCTGAACACCAAAGGCAGGCAGGCATCCCAATTAATGAAAACTGTCTTTACATCCTCTC
                      ____________________________________________________________
consensus CGCTGAACACCAAAGGCAGGCAGGCATCCCAATTAATGAAAACTGTCTTTACATCCTCTC
 
. : . : . : . : . : . :
rJMSF041K19- AAATGCTCTATCAGGCCAGGGTGTAGAGGACCCTTGGGGTTGAGGATTCAACCTTTTGAA
rJMSF041P11- AAATGCTCTATCAGGCCAGGGTGTAGAGGACCCTTGGGGTTGAGGATTCAACCTTTTGAA
                      ____________________________________________________________
consensus AAATGCTCTATCAGGCCAGGGTGTAGAGGACCCTTGGGGTTGAGGATTCAACCTTTTGAA
 
. : . : . : . : . : . :
rJMSF041K19- AGAAAAAAACTCTTAAGTGAGATGATTTATGCCACAGCAGAAATCATAATTGCCACCAAA
rJMSF041P11- AGAAAAAAACTCTTAAGTGAGATGATTTATGCCACAGCAGAAATCATAATTGCCACCAAA
                      ____________________________________________________________
consensus AGAAAAAAACTCTTAAGTGAGATGATTTATGCCACAGCAGAAATCATAATTGCCACCAAA
 
. : . : . : . : . : . :
rJMSF041K19- CAACTGACAGCATTTTGTATCTTCAGGCTTTCACCACCAATGTACCTTACATAATCTTGT
rJMSF041P11- CAACTGACAGCATTTTGTATCTTCAGGCTTTCACCACCAATGTACCTTACATAATCTTGT
                      ____________________________________________________________
consensus CAACTGACAGCATTTTGTATCTTCAGGCTTTCACCACCAATGTACCTTACATAATCTTGT
 
. : . : . : . : . : . :
rJMSF041K19- GTGATTGTATGAAGTATGTGATAGTATGTATTCCAACTATCCTTAGGAAAGATCTGGAAT
rJMSF041P11- GTGATTGTATGAAGTATGTGATAGTATGTATTCCAACTATCCTTAGGAAAGATCTGGAAT
                      ____________________________________________________________
consensus GTGATTGTATGAAGTATGTGATAGTATGTATTCCAACTATCCTTAGGAAAGATCTGGAAT
 
. : . : . : . : . : . :
rJMSF041K19- TGTACCACTCTTTAGATAGTTAGACAGAAAAGATAACTCTTCCTGAGGCCCCCGCCAACG
rJMSF041P11- TGTACCACTCTTTAGATAGTTAGACAGAAAAGATAACTCTTCCTGAGGCCCCCGCCAACG
JMFN006P22+ GTTAAACAGAAAAGATAACTCTTTCCGAGGCCCCCGCCGACG
JMFS042H02+ AGGCCCCCGCCACGG
                      ____________________________________________________________
consensus TGTACCACTCTTTAGATAGTTAGACAGAAAAGATAACTCTTCCTGAGGCCCCCGCCAACG
 
. : . : . : . : . : . :
rJMSF041K19- TCTCCAGACTCTCTACCGTTGCCGTCAACCGCCACGTCCCGGTTCA-GGAATTTTAACCC
rJMSF041P11- TCTCCAGACTCTCTACCGTTGCCGTCAACCGCCACGTCCCGGTTCA-GGAATTTTAACCC
JMFN006P22+ TCTCCGGAATCCCTAACGTTGCCGTCAACCGCCACGTCCCGGTTCA-GGAATTTTAACCC
JMFS042H02+ TCTCCGGAATCCCTACGGTTGCCGTCAACCGCCACGTCCCGGGTCAGGGAATTTTAACCC
                      ____________________________________________________________
consensus TCTCCGGACTCTCTACCGTTGCCGTCAACCGCCACGTCCCGGTTCA-GGAATTTTAACCC
 
. : . : . : . : . : . :
rJMSF041K19- GA
rJMSF041P11- GA
JMFN006P22+ GATTCCCTTTCGGCGCACGCGCAAAACGCGCTGTCTGTCGGGCTTCCCCCGACCCTTAGG
JMFS042H02+ GATTCCCTTTCGGCGCACGCGCAAAACGCGCTGTCTGTCGGGCTTCCCCCGACCCTTAGG
                      ____________________________________________________________
consensus GATTCCCTTTCGGCGCACGCGCAAAACGCGCTGTCTGTCGGGCTTCCCCCGACCCTTAGG
 
. : . : . : . : . : . :
JMFN006P22+ ATCGACTAACCCATGTGCAAGTGCCGTTCACATGGAACCTTTCCCCTCTTCGGCCTTCAA
JMFS042H02+ ATCGACTAACCCATGTGCAAGTGCCGTTCACATGGAACCTTTCCCCTCTTCGGCCTTCAA
                      ____________________________________________________________
consensus ATCGACTAACCCATGTGCAAGTGCCGTTCACATGGAACCTTTCCCCTCTTCGGCCTTCAA
 
. : . : . : . : . : . :
JMFN006P22+ AGTTCTCATTTGAATATTTGCTACTACCACCAAGATCTGCACCGACGGC
JMFS042H02+ AGTTCTCATTTGAATATTTGCTACTACCACCAAGATCTGCACCGACGGCCGCTCCGCCCG
JMFS005F05+ GCACCGACGGCCGCTCCGCCCG
JMFS165D04+ GCCCG
JMFS092E08+ GCACCGACGGCCGCTCCGCCCG
                      ____________________________________________________________
consensus AGTTCTCATTTGAATATTTGCTACTACCACCAAGATCTGCACCGACGGCCGCTCCGCCCG
 
. : . : . : . : . : . :
JMFS042H02+ GGCTCGCGCCCAAGGTTTTGCAGCGACCGCCGCGCCCTCCTACTCATCGGGGCCTAGCTC
JMFS005F05+ GGCTCGCGCCCAAGGTTTTGCAGCGACCGCCGCGCCCTCCTACTCATCGGGGCCTAGCTC
JMFS165D04+ GGCTCGCGCCCAAGGTTTTGCAGCGACCGCCGCGCCCTCCTACTCATCGGGGCCTAGCTC
JMFS092E08+ GGCTCGCGCCCAAGGTTTTGCAGCGACCGCCGCGCCCTCCTACTCATCGGGGCCTAGCTC
JMFS153B04+ CATCGGGGGCTAGCTC
                      ____________________________________________________________
consensus GGCTCGCGCCCAAGGTTTTGCAGCGACCGCCGCGCCCTCCTACTCATCGGGGCCTAGCTC
 
. : . : . : . : . : . :
JMFS042H02+ TTGCCCCGACGGCCGGGTATAGGTCGCGCGCTTAAGCGCCATCCATTTTCGGGGCTAGTT
JMFS005F05+ TTGCCCCGACGGCCGGGTATAGGTCGCGCGCTTAAGCGCCATCCATTTTCGGGGCTAGTT
JMFS165D04+ TTGCCCCGACGGCCGGGTATAGGTCGCGCGCTTAAGCGCCATCCATTTTCGGGGCTAGTT
JMFS092E08+ TTGCCCCGACGGCCGGGTATAGGTCGCGCGCTTAAGCGCCATCCATTTTCGGGGCTAGTT
JMFS153B04+ TTGCCCCGACGGCCGGGTATAGGTCGCGCGCTTAAGCGCCATCCATTTTCGGGGCTAGTT
JMFF051J20+ TAGGTCGCGCGCTTAAGCGCCATCCATTTTCGGGGCTAGTT
JMFS034E01+ CATCCATTTTCGGGGCTAGTT
JMFS065C11+ TCCATTTTCGGGGCTAGTT
JMFS070E01+ GGGGCTAGTT
JMFF042C12+ CTAGTT
                      ____________________________________________________________
consensus TTGCCCCGACGGCCGGGTATAGGTCGCGCGCTTAAGCGCCATCCATTTTCGGGGCTAGTT
 
. : . : . : . : . : . :
JMFS042H02+ GATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGA-TTTCGACTTCCATGACCACCGT
JMFS005F05+ GATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGA-TTTCGACTTCCATGACCACCGT
JMFS165D04+ GATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGA-TTTCGACTTCCATGACCACCGT
JMFS092E08+ GATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGA-TTTCGACTTCCATGACCACCGT
JMFS153B04+ GATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGA-TTTCGACTTCCATGACCACCGT
JMFF051J20+ GATTCGGCAGGTGAGTTG-TACACACTCCTTAGCGGA-TTTCGACTTCCATGACCACCGT
JMFS034E01+ GATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGA-TTTCGACTTCCATGACCACCGT
JMFS065C11+ GATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGA-TTTCGACTTCCATGACCACCGT
JMFS070E01+ GATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGA-TTTCGACTTCCATGACCACCGT
JMFS088B09+ TCGGCAGGTGAGTTGTTACACACTCCTTAGCGGA-TTTCGACTTCCATGACCACCGT
JMFS081G07+ AGGTGAGTTGTTACACACTCCTTAGCGGA-TTTCGACTTCCATGACCACCGT
JMFS017B10+ AGGTGAGTTGTTACACACTCCTTAGCGGA-TTTCGACTTCCATGACCACCGT
JMFS066C10+ CGGCAGGTGAGTTGTTACACACTCCTTAGCGGA-TTTCGACTTCCATGACCACCGT
JMFS094B09+ TGAGTTGTTACACACTCCTTAGCGGA-TTTCGACTTCCATGACCACCGT
JMFS054D05+ TCGGCAGGTGAGTTGTTACACACTCCTTAGCGGA-TTTCGACTTCCATGACCACCGT
JMFS037B03+ TTCGGCAGGTGAGTTGTTACACACTCCTAAGCGGA-TTTCGACTTCCATGACCACCGT
JMFS049A05+ ATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGA-TTTCGACTTCCATGACCACCGT
JMFS099F01+ TAGCGGA-TTTCGACTTCCATGACCACCGT
JMFS144D07+ TACACACTCCTTAGCGGA-TTTCGACTTCCATGACCACCGT
JMFS065F02+ ATTTCGACTTCCATGACCACCGT
JMFS005C11+ ATTTCGACTTCCATGACCACCGT
JMFF046L08+ TTACACACTCC-TAGCGGATTTTCGACTTCCATGACCACCGT
JMFF042C12+ GATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGA-TTTCGACTTCCATGACCACCGT
                      ____________________________________________________________
consensus GATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGA-TTTCGACTTCCATGACCACCGT
 
. : . : . : . : . : . :
JMFS042H02+ CCTGCTGTCTTAATCGACCAACACCCTTTGTGGGATCTAGGTTAGCGCGCAGTTGGGCAC
JMFS005F05+ CCTGCTGTCTTAATCGACCAACACCCTTTGTGGGATCTAGGTTAGCGCGCAGTTGGGCAC
JMFS165D04+ CCTGCTGTCTTAATCGACCAACACCCTTTGTGGGATCTAGGTTAGCGCGCAGTTGGGCAC
JMFS092E08+ CCTGCTGTCTTAATCGACCAACACCCTTTGTGGGATCTAGGTTAGCGCGCAGTTGGGCAC
JMFS153B04+ CCTGCTGTCTTAATCGACCAACACCCTTTGTGGGATCTAGGTTAGCGCGCAGTTGGGCAC
JMFF051J20+ CCTGCTGTCTTAATCGACCAACACCCTTTGTGGGATCTAGGTTAGCGCGCAGTTGGGCAC
JMFS034E01+ CCTGCTGTCTTAATCGACCAACACCCTTTGTGGGATCTAGGTTAGCGCGCAGTTGGGCAC
JMFS065C11+ CCTGCTGTCTTAATCGACCAACACCCTTTGTGGGATCTAGGTTAGCGCGCAGTTGGGCAC
JMFS070E01+ CCTGCTGTCTTAATCGACCAACACCCTTTGTGGGATCTAGGTTAGCGCGCAGTTGGGCAC
JMFS088B09+ CCTGCTGTCTTAATCGACCAACACCCTTTGTGGGATCTAGGTTAGCGCGCAGTTGGGCAC
JMFS081G07+ CCTGCTGTCTTAATCGACCAACACCCTTTGTGGGATCTAGGTTAGCGCGCAGTTGGGCAC
JMFS017B10+ CCTGCTGTCTTAATCGACCAACACCCTTTGTGGGATCTAGGTTAGCGCGCAGTTGGGCAC
JMFS066C10+ CCTGCTGTCTTAATCGACCAACACCCTTTGTGGGATCTAGGTTAGCGCGCAGTTGGGCAC
JMFS094B09+ CCTGCTGTCTTAATCGACCAACACCCTTTGTGGGATCTAGGTTAGCGCGCAGTTGGGCAC
JMFS054D05+ CCTGCTGTCTTAATCGACCAACACCCTTTGTGGGATCTAGGTTAGCGCGCAGTTGGGCAC
JMFS037B03+ CCTGCTGTCTTAATCGACCAACACCCTTTGTGGGATCTAGGTTAGCGCGCAGTTGGGCAC
JMFS049A05+ CCTGCTGTCTTAATCGACCAACACCCTTTGTGGGATCTAGGTTAGCGCGCAGTTGGGCAC
JMFS099F01+ CCTGCTGTCTTAATCGACCAACACCCTTTGTGGGATCTAGGTTAGCGCGCAGTTGGGCAC
JMFS144D07+ CCTGCTGTCTTAATCGACCAACACCCTTTGTGGGATCTAGGTTAGCGCGCAGTTGGGCAC
JMFS065F02+ CCTGCTGTCTTAATCGACCAACACCCTTTGTGGGATCTAGGTTAGCGCGCAGTTGGGCAC
JMFS116G08+ GACCAACACCCTTTGTGGGATCTAGGTTAGCGCGCAGTTGGGCAC
JMFS005C11+ CCTGCTGTCTTAATCGACCAACACCCTTTGTGGGATCTAGGTTAGCGCGCAGTTGGGCAC
JMFF046L08+ CCTGCTGTCTTAATCGACCAACACCCTTTGTGGGATCTAGGTTAGCGCGCAGTTGGGCAC
JMFF042C12+ CCTGCTGTCTTAATCGACCAACACCCTTTGTGGGATCTAGGTTAGCGCGCAGTTGGGCAC
                      ____________________________________________________________
consensus CCTGCTGTCTTAATCGACCAACACCCTTTGTGGGATCTAGGTTAGCGCGCAGTTGGGCAC
 
. : . : . : . : . : . :
JMFS042H02+ CGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACT
JMFS005F05+ CGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACT
JMFS165D04+ CGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACT
JMFS092E08+ CGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACT
JMFS153B04+ CGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACT
JMFF051J20+ CGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACT
JMFS034E01+ CGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACT
JMFS065C11+ CGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCAGT
JMFS070E01+ CGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACT
JMFS088B09+ CGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACT
JMFS081G07+ CGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACT
JMFS017B10+ CGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACT
JMFS066C10+ CGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACT
JMFS094B09+ CGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACT
JMFS054D05+ CGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACT
JMFS037B03+ CGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACT
JMFS049A05+ CGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACT
JMFS099F01+ CGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACT
JMFS144D07+ CGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACT
JMFS065F02+ CGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACT
JMFS116G08+ CGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACT
JMFS005C11+ CGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACT
JMFS150H01+ CCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACT
JMFF046L08+ CGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACT
JMFS144H08+ GGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACT
JMFS036H08+ GCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACT
JMFF048F17+ ATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACT
JMFF042C12+ CGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACT
                      ____________________________________________________________
consensus CGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACT
 
. : . : . : . : . : . :
JMFS042H02+ TGGAGCTGTTGATTGCCGTGGCGCGGCTCAACGAAGCAGCCGCG-CCG
JMFS005F05+ TGGAGCTGTTGATT-CCGTGGCGCGGCTCAACGAAGCAGCCGCG-CCGTCCTA-CCTATT
JMFS165D04+ TGGAGCTGTTGATT-CCGTGGCGCGGCTCAACGAAGCAGCCGCG-CCGTCCTA-CCTATT
JMFS092E08+ TGGAGCTGTTGATT-CCGTGGCGCGGCTCAACGAAGCAGCCGCG-CCGTCCTA-CCTATT
JMFS153B04+ TGGAGCTGTTGATT-CCGTGGCGCGGCTCAACGAAGCAGCCGCG-CCGTCCTA-CCTATT
JMFF051J20+ TGGAGCTGTTGATT-CCGTGGCGCGGCTCAACGAAGCAGCCGCG-CCGTCCTA-CCTATT
JMFS034E01+ TGGAGCTGTTGATT-CCGTGGCGCGGCTCAACGAAGCAGCCGCG-CCGTCCTA-CCTATT
JMFS065C11+ TGGAGCTGTTGATT-CCGTGGCGCGGCTCAACGAAGCAGCCGCG-CCGTCCTA-CCTATT
JMFS070E01+ TGGAGCTGTTGATT-CCGTGGCGCGGCTCAACGAAGCAGCCGCG-CCGTCCTA-CCTATT
JMFS088B09+ TGGAGCTGTTGATT-CCGTGGCGCGGCTCAACGAAGCAGCCGCG-CCGTCCTA-CCTATT
JMFS081G07+ TGGAGCTGTTGATT-CCGTGGCGCGGCTCAACGAAGCAGCCGCG-CCGTCCTA-CCTATT
JMFS017B10+ TGGAGCTGTTGATT-CCGTGGCGCGGCTCAACGAAGCAGCCGCG-CCGTCCTA-CCTATT
JMFS066C10+ TGGAGCTGTTGATT-CCGTGGCGCGGCTCAACGAAGCAGCCGCG-CCGTCCTA-CCTATT
JMFS094B09+ TGGAGCTGTTGATT-CCGTGGCGCGGCTCAACGAAGCAGCCGCG-CCGTCCTA-CCTATT
JMFS054D05+ TGGAGCTGTTGATT-CCGTGGCGCGGCTCAANGAAGCAGCCGCG-CCGTCCTA-CCTATT
JMFS037B03+ TGGAGCTGTTGATT-CCGTGGCGCGGCTCAACGAAGCAGCCGCG-CCGTCCTA-CCTATT
JMFF038C12+ CGTCCTACCTTATT
JMFS049A05+ TGGAGCTGTTGATT-CCGTGGCGCGGCTCAACGAAGCAGCCGCGCCCGTCCTACCCTATT
JMFS099F01+ TGGAGCTGTTGATT-CCGTGGCGCGGCTCAACGAAGCAGCCGCG-CCGTCCTA-CCTATT
JMFS144D07+ TGGAGCTGTTGATT-CCGTGGCGCGGCTCAACGAAGCAGCCGCG-CCGTCCTA-CCTA-T
JMFS065F02+ TGGAGCTGTTGATT-CCGTGGCGCGGCTCAACGAAGCAGCCGCG-CCGTCCTA-CCTATT
JMFS116G08+ TGGAGCTGTTGATT-CCGTGGCGCGGCTCAACGAAGCAGCCGCG-CCGTCCTA-CCTATT
JMFS005C11+ TGGAGCTGTTGATT-CCGTGGCGCGGCTCAACGAAGCAGCCGCG-CCGTCCTA-CCTATT
JMFS150H01+ TGGAGCTGTTGATT-CCGTGGCGCGGCTCAACGAAGCAGCCGCG-CCGTCCTA-CCTATT
JMFF046L08+ TGGAGCTGTTGATT-CCGTGGCGCGGCTCAACGAAGCAGCCGCG-CCGTCCTA-CCTATT
JMFS144H08+ TGGAGCTGTTGATT-CCGTGGCGCGGCTCAACGAAGCAGCCGCG-CCGTCCTA-CCTATT
JMFS036H08+ TGGAGCTGTTGATT-CCGTGGCGCGGCTCAACGAAGCAGCCGCG-CCGTCCTA-CCTATT
JMFF048F17+ TGGAGCTGTTGATT-CCGTGGCGCGGCTCAACGAAGCAGCCGCG-CCGTCCTA-CCTATT
JMFF042C12+ TGGAGCTGTTGATT-CCGTGGCGCGGCTCAACGAAGCAGCCGCG-CCGTCCTA-CCTATT
                      ____________________________________________________________
consensus TGGAGCTGTTGATT-CCGTGGCGCGGCTCAACGAAGCAGCCGCG-CCGTCCTA-CCTATT
 
. : . : . : . : . : . :
JMFS005F05+ TAAAGTTTGAGAATAGGTCGAGGGCGTTACGCCCCCGATG-CCTCTAATCATTGGCTTTA
JMFS165D04+ TAAAGTTTGAGAATAGGTCGAGGGCGTTACGCCCCCGATG-CCTCTAATCATTGGCTTTA
JMFS092E08+ TAAAGTTTGAGAATAGGTCGAGGGCGTTACGCCCCCGATG-CCTCTAATCATTGGCTTTA
JMFS153B04+ TAAAGTTTGAGAATAGGTCGAGGGCGTTACGCCCCCGATG-CCTCTAATCATTGGCTTTA
JMFF051J20+ TAAAGTTTGAGAATAGGTCGAGGGCGTTACGCCCCCGATG-CCTCTAATCATTGGCTTTA
JMFS034E01+ TAAAGTTTGAGAATAGGTCGAGGGCGTTACGCCCCCGATG-CCTCTAATCATTGGCTTTA
JMFS065C11+ TAAAGTTTGAGAATAGGTCGAGGGCGTTACGCCCCCGATG-CCTCTAATCATTGGCTTTA
JMFS070E01+ TAAAGTTTGAGAATAGGTCGAGGGCGTTACGCCCCCGATG-CCTCTAATCATTGGCTTTA
JMFS088B09+ TAAAGTTTGAGAATAGGTCGAGGGCGTTACGCCCCCGATG-CCTCTAATCATTGGCTTTA
JMFS081G07+ TAAAGTTTGAGAATAGGTCGAGGGCGTTACGCCCCCGATG-CCTCTAATCATTGGCTTTA
JMFS017B10+ TAAAGTTTGAGAATAGGTCGAGGGCGTTACGCCCCCGATG-CCTCTAATCATTGGCTTTA
JMFS066C10+ TAAAGTTTGAGAATAGGTCGAGGGCGTTACGCCCCCGATG-CCTCTAATCATTGGCTTTA
JMFS094B09+ TAAAGTTTGAGAATAGGTCGAGGGCGTTACGCCCCCGATG-CCTCTAATCATTGGCTTTA
JMFS054D05+ TAAAGTTTGAGAATAGGTCGAGGGCGTTACGCCCCCGATG-CCTCTAATCATTGGCTTTA
JMFS037B03+ TAAAGTTTGAGAATAGGTCGAGGGCGTTACGCCCCCGATG-CCTCTAATCATTGGCTTTA
JMFF038C12+ TAAAGTTTGAGAATAGGTCGAGGGCGTTACGCCCCCGATGCCCTCTAATCATTGGCTTTA
JMFS049A05+ TAAAGTTTGAGAATAGGTCGAGGGCGTTACGCCCCCGATG-CCTCTAATCATTGGCTTTA
JMFS099F01+ TAAAGTTTGAGAATAGGTCGAGGGCGTTACGCCCCCGATG-CCTCTAATCATTGGCTTTA
JMFS144D07+ TAAAGTTTGAGAATAGGTCGAGGGCATTACGCCCCCGATG-CCTCTAATCATTGGCTTTA
JMFS065F02+ TAAAGTTTGAGAATAGGTCGAGGGCGTTACGCCCCCGATG-CCTCTAATCATTGGCTTTA
JMFS116G08+ TAAAGTTTGAGAATAGGTCGAGGGCGTTACGCCCCCGATG-CCTCTAATCATTGGCTTTA
JMFS005C11+ TAAAGTTTGAGAATAGGTCGAGGGCGTTACGCCCCCGATG-CCTCTAATCATTGGCTTTA
JMFS150H01+ TAAAGTTTGAGAATAGGTCGAGGGCGTTACGCCCCCGATG-CCTCTAATCATTGGCTTTA
JMFF046L08+ TAAAGTTTGAGAATAGGTCGAGGGCGTTACGCCCCCGATG-CCTCTAATCATTGGCTTTA
JMFS144H08+ TAAAGTTTGAGAATAGGTCGAGGGCGTTACGCCCCCGATG-CCTCTAATCATTGGCTTTA
JMFS036H08+ TAAAGTTTGAGAATAGGTCGAGGGCGTTACGCCCCCGATG-CCTCTAATCATTGGCTTTA
JMFF048F17+ TAAAGTTTGAGAATAGGTCGAGGGCGTTACGCCCCCGATG-CCTCTAATCATTGGCTTTA
JMFF042C12+ TAAAGTTTGAGAATAGGTCGAGGGCGTTACGCCCCCGATG-CCTCTAATCATTGGCTTTA
                      ____________________________________________________________
consensus TAAAGTTTGAGAATAGGTCGAGGGCGTTACGCCCCCGATG-CCTCTAATCATTGGCTTTA
 
. : . : . : . : . : . :
JMFS005F05+ CCCGATAGAACTCTCGCGCCAGCTCCAGCTATCCTGAGGGGAACTTCGGAGGGAACCAGC
JMFS165D04+ CCCGATAGAACTCTCGCGCCAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGC
JMFS092E08+ CCCGATAGAACTCTCGCGCCAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGC
JMFS153B04+ CCCGATAGAACTCTCGCGCCAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGC
JMFF051J20+ CCCGATAGAACTCTCGCGCCAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGC
JMFS034E01+ CCCGATAGAACTCTCGCGCCAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGC
JMFS065C11+ CCCGATAGAACTCTCGCGCCAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGC
JMFS070E01+ CCCGATAGAACTCTCGCGCCAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGC
JMFS088B09+ CCCGATAGAACTCTCGCGCCAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGC
JMFS081G07+ CCCGATAGAACTCTCGCGCCAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGC
JMFS017B10+ CCCGATAGAACTCTCGCGCCAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGC
JMFS066C10+ CCCGATAGAACTCTCGCGCCAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGC
JMFS094B09+ CCCGATAGAACTCTCGCGCCAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGC
JMFS054D05+ CCCGATAGAACTCTCGCGCCAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGC
JMFS037B03+ CCCGATAGAACTCTCGCGCCAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGC
JMFF038C12+ CCCGATAGAACTCTCGCGCCAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGC
JMFS049A05+ CCCGATAGAACTCTCGCGCCAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGC
JMFS099F01+ CCCGATAGAACTCTCGCGCCAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGC
JMFS144D07+ CCCGATAGAACTCTCGCGCCAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGC
JMFS065F02+ CCCGATAGAACTCTCGCGCCAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGC
JMFS116G08+ CCCGATAGAACTCTCGCGCCAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAAC
JMFS005C11+ CCCGATAGAACTCTCGCGCCAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGC
JMFS150H01+ CCCGATAGAACTCTCGCGCCAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGC
JMFF046L08+ CCCGATAGAACTCTCGCGCCAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGC
JMFS144H08+ CCCGATAGAACTCTCGCGCCAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGC
JMFS036H08+ CCCGATAGAACTCTCGCGCCAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGC
JMFF048F17+ CCCGATAGAACTCTCGCGCCAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGC
JMFF042C12+ CCCGATAGAACTCTCGCGCCAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGC
JMFS111G09+ TCGGAGGGAACCAGC
JMFS094D10+ C
                      ____________________________________________________________
consensus CCCGATAGAACTCTCGCGCCAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGC
 
. : . : . : . : . : . :
JMFS005F05+ TACTAGACGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGA
JMFS165D04+ TACTAGACGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACAAACGATTTGCACG
JMFS092E08+ TACTAGACGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACG
JMFS153B04+ TACTAGACGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACG
JMFF051J20+ TACTAGACGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACG
JMFS034E01+ TACTAGACGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACG
JMFS065C11+ TACTAGACGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACG
JMFS070E01+ TACTAGACGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACG
JMFS088B09+ TACTAGACGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACG
JMFS081G07+ TACTAGACGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACG
JMFS017B10+ TACTAGACGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACG
JMFS066C10+ TACTAGACGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACG
JMFS094B09+ TACTAGACGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACG
JMFS054D05+ TACTAGACGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCCTG
JMFS037B03+ TACTAGACGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACG
JMFF038C12+ TACTAGACGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACG
JMFS049A05+ TACTAGACGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACG
JMFS099F01+ TACTAGACGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACG
JMFS144D07+ TACTAGACGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACG
JMFS065F02+ TACTAGACGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACG
JMFS116G08+ TACTAGACGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACG
JMFS005C11+ TACTAGACGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACG
JMFS150H01+ TACTAGACGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACG
JMFF046L08+ TACTAGACGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACG
JMFS144H08+ TACTAGACGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACG
JMFS036H08+ TACTAGACGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACG
JMFF048F17+ TACTAGACGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACG
JMFF042C12+ TACTAGACGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACG
JMFS111G09+ TACTAGACGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACG
JMFS094D10+ TACTAGACGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACG
                      ____________________________________________________________
consensus TACTAGACGGTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACG
 
. : . : . : . : . : . :
JMFS165D04+ TCAGTATCGCTGCGGGCCTCCACCAGA
JMFS092E08+ TCAGTATCGCTGCGGGCCTCCACCAGAGTTTCCTCTGGCTTC
JMFS153B04+ TCAGTATCGCTGCGGGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGCATAGT
JMFF051J20+ TCAGTATCGCTGCGGGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGCATAGT
JMFS034E01+ TCAGTATCGCTGCGGGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGCATAGT
JMFS065C11+ TCAGTATCGCTGCGGGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGCATAGT
JMFS070E01+ TCAGTATCGCTGCGGGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGCATAGT
JMFS088B09+ TCAGTATCGCTGCGGGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGCATAGT
JMFS081G07+ TCAGTATCGCTGCGGGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGCATAGT
JMFS017B10+ TCAGTATCGCTGCGGGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGCATAGT
JMFS066C10+ TCAGTATCGCTGCGGGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGCATAGT
JMFS094B09+ TCAGTATCGCTGCGGGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGCATAGT
JMFS054D05+ TCAGTATCGCTGCGGGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGCATAGT
JMFS037B03+ TCAGTATCGCTGCGGGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGCATAGT
JMFF038C12+ TCAGTATCGCTGCGGGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGCATAGT
JMFS049A05+ TCAGTATCGCTGCGGGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGCATAGT
JMFS099F01+ TCAGTATCGCTGCGGGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGCATAGT
JMFS144D07+ TCAGTATCGCTGCGGGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGCATAGT
JMFS065F02+ TCAGTATCGCTGCGGGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGCATAGT
JMFS116G08+ TCAGTATCGCTGCGGGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGCATAGT
JMFS005C11+ TCAGTATCGCTGCGGGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGCATAGT
JMFS150H01+ TCAGTATCGCTGCGGGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGCATAGT
JMFF046L08+ TCAGTATCGCTGCGGGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGCATAGT
JMFS144H08+ TCAGTATCGCTGCGGGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGCATAGT
JMFS036H08+ TCAGTATCGCTGCGGGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGCATAGT
JMFF048F17+ TCAGTATCGCTGCGGGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGCATAGT
JMFF042C12+ TCAGTATCGCTGCGGGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGCATAGT
JMFS111G09+ TCAGTATCGCTGCGGGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGCATAGT
JMFS094D10+ TCAGTATCGCTGCGGGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGCATAGT
                      ____________________________________________________________
consensus TCAGTATCGCTGCGGGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGCATAGT
 
. : . : . : . : . : . :
JMFS153B04+ TCACCATCTTTCGGGTCCCGACAGGTATGCTCGCACTCGAACCCTTCTCAGAAGATCAAG
JMFF051J20+ TCACCATCTTTCGGGTCCCGACAGGTATGCTCGCACTCGAACCCTTCTCAGAAGATCAAG
JMFS034E01+ TCACCATCTTTCGGGTCCCGACAGGTATGCTCGCACTCGAACCCTTCTCAGAAGATCAAG
JMFS065C11+ TCACCATCTTTCGGGTCCCGACAGGTATGCTCGCACTCGAACCCTTCTCAGAAGATCAAG
JMFS070E01+ TCACCATCTTTCGGGTCCCGACAGGTATGCTCGCACTCGAACCCTTCTCAGAAGATCAAG
JMFS088B09+ TCACCATCTTTCGGGTCCCGACAGGTATGCTCGCACTCGAACCCTTCTCAGAAGATCAAG
JMFS081G07+ TCACCATCTTTCGGGTCCCGACAGGTATGCTCGCACTCGAACCCTTCTCAGAAGATCAAG
JMFS017B10+ TCACCATCTTTCGGGTCCCGACAGGTATGCTCGCACTCGAACCCTTCTCAGAAGATCAAG
JMFS066C10+ TCACCATCTTTCGGGTCCCGACAGGTATGCTCGCACTCGAACCCTTCTCAGAAGATCAAG
JMFS094B09+ TCACCATCTTTCGGGTCCCGACAGGTATGCTCGCACTCGAACCCTTCTCAGAAGATCAAG
JMFS054D05+ TCACCATCTTTCGGGTCCCGACAGGTATGCTCGCACTCGAACCCTTCTCAGAAGATCAAG
JMFS037B03+ TCACCATCTTTCGGGTCCCGACAGGTATGCTCGCACTCGAACCCTTCTCAGAAGATCAAG
JMFF038C12+ TCACCATCTTTCGGGTCCCGACAGGTATGCTCGCACTCGAACCCTTCTCAGAAGATCAAG
JMFS049A05+ TCACCATCTTTCGGGTCCCGACAGGTATGCTCGCACTCGAACCCTTCTCAGAAGATCAAG
JMFS099F01+ TCACCATCTTTCGGGTCCCGACAGGTATGCTCGCACTCGAACCCTTCTCAGAAGATCAAG
JMFS144D07+ TCACCATCTTTCGGGTCCCGACAGGTATGCTCGCACTCGAACCCTTCTCAGAAGATCAAG
JMFS065F02+ TCACCATCTTTCGGGTCCCGACAGGTATGCTCGCACTCGAACCCTTCTCAGAAGATCAAG
JMFS116G08+ TCACCATCTTTCGGGTCCCGACAGGTATGCTCGCACTCGAACCCTTCTCAGAAGATCAAG
JMFS005C11+ TCACCATCTTTCGGGTCCCGACAGGTATGCTCGCACTCGAACCCTTCTCAGAAGATCAAG
JMFS150H01+ TCACCATCTTTCGGGTCCCGACAGGTATGCTCGCACTCGAACCCTTCTCAGAAGATCAAG
JMFF046L08+ TCACCATCTTTCGGGTCCCGACAGGTATGCTCGCACTCGAACCCTTCTCAGAAGATCAAG
JMFS144H08+ TCACCATCTTTCGGGTCCCGACAGGTATGCTCGCACTCGAACCCTTCTCAGAAGATCAAG
JMFS036H08+ TCACCATCTTTCGGGTCCCGACAGGTATGCTCGCACTCGAACCCTTCTCAGAAGATCAAG
JMFF048F17+ TCACCATCTTTCGGGTCCCGACAGGTATGCTCGCACTCGAACCCTTCTCAGAAGATCAAG
JMFF042C12+ TCACCATCTTTCGGGTCCCGACAGGTATGCTCGCACTCGAACCCTTCTCAGAAGATCAAG
JMFS111G09+ TCACCATCTTTCGGGTCCCGACAGGTATGCTCGCACTCGAACCCTTCTCAGAAGATCAAG
JMFS094D10+ TCACCATCTTTCGGGTCCCGACAGGTATGCTCGCACTCGAACCCTTCTCAGAAGATCAAG
                      ____________________________________________________________
consensus TCACCATCTTTCGGGTCCCGACAGGTATGCTCGCACTCGAACCCTTCTCAGAAGATCAAG
 
. : . : . : . : . : . :
JMFS153B04+ G
JMFF051J20+ G
JMFS034E01+ GTCGGTCGGCGGTGCACCCCCGTGAGGGGATCCCGCCAATCAGCTTC
JMFS065C11+ GTCGGTCGGCGGTGCACCCCCGTGAGGGGATCCCGCCAATCAGCTTCCTTGCGCCTTACG
JMFS070E01+ GTCGGTCGGCGGTGCACCCCCGTGAGGGGATCCCGCCAATCAGCTTCCTTGCGCCTTACG
JMFS088B09+ GTCGGTCGGCGGTGCACCCCCGTGAGGGGATCCCGCCAATCAGCTTCCTTGCGCCTTACG
JMFS081G07+ GTCGGTCGGCGGTGCACCCCCGTGAGGGGATCCCGCCAATCAGCTTCCTTGCGCCTTACG
JMFS017B10+ GTCGGTCGGCGGTGCACCCCCGTGAGGGGATCCCGCCAATCAGCTTCCTTGCGCCTTACG
JMFS066C10+ GTCGGTCGGCGGTGCACCCCCGTGAGGGGATCCCGCCAATCAGCTTCCTTGCGCCTTACG
JMFS094B09+ GTCGGTCGGCGGTGCACCCCCGTGAGGGGATCCCGCCAATCAGCTTCCTTGCGCCTTACG
JMFS054D05+ GTCGGTCGGCGGTGCACCCCCGTGAGGGGATCCCGCCAATCAGCTTCCTTGCGCCTTACG
JMFS037B03+ GTCGGTCGGCGGTGCACCCCCGTGAGGGGATCCCGCCAATCAGCTTCCTTGCGCCTTACG
JMFF038C12+ GT
JMFS049A05+ GTCGGTCGGCGGTGCACCCCCGTGAGGGGATCCCGCCAATCAGCTTCCTTGCGCCTTACG
JMFS099F01+ GTCGGTCGGCGGTGCACCCCCGTGAGGGGATCCCGCCAATCAGCTTCCTTGCGCCTTACG
JMFS144D07+ GTCGGTCGGCGGTGCACCCCCGTGAGGGGATCCCGCCAATCAGCTTCCTTGCGCCTTACG
JMFS065F02+ GTCGGTCGGCGGTGCACCCCCGTGAGGGGATCCCGCCAATCAGCTTCCTTGCGCCTTACG
JMFS116G08+ GTCGGTCGGCGGTGCACCCCCGTGAGGGGATCCCGCCAATCAGCTTCCTTGCGCCTTACG
JMFS005C11+ GTCGGTCGGCGGTGCACCCCCGTGAGGG
JMFS150H01+ GTCGGTCGGCGGTGCACCCCCGTGAGGGGATCCCGCCAATCAGCTTCCTTGCGCCTTACG
JMFF046L08+ G
JMFS144H08+ GTCGGTCGGCGGTGCACCCCCGTGAGGGGATCCCGCCAATCAGCTTCCTTGCGCCTTACG
JMFS036H08+ GTCGGTCGGCGGTGCACCCCCGTGAGGGGATCCCGCCAATCAGCTTCCTTGCGCCTTACG
JMFF048F17+ GT
JMFF042C12+ GTCGGTCGGCGGTGCACCCCCGTGAGGGGATCCCGCCAATCAGCTTCCTTGCGCCTTACG
JMFS111G09+ GTCGGTCGGCGGTGCACCCCCGTGAGGGGATCCCGCCAATCAGCTTCCTTGCGCCTTACA
JMFS094D10+ GTCGGTCGGCGGTGCACCCCCGTGAGGGGATCCCGCCAATCAGCTTCCTTGCGCCTTACG
                      ____________________________________________________________
consensus GTCGGTCGGCGGTGCACCCCCGTGAGGGGATCCCGCCAATCAGCTTCCTTGCGCCTTACG
 
. : . : . : . : . : . :
JMFS065C11+ GGTTTACTCGCCC
JMFS070E01+ GGTTTACTCGCCCGTTGA
JMFS088B09+ GGTTTACTCGCCCGTTGACTCGCACACATGTCAGA
JMFS081G07+ GGTTTACTCGCCCGTTGACTCGCACACATGTCAGACTCCT
JMFS017B10+ GGTTTACTCGCCCGTTGACTCGCACACATGTCAGACTCCT
JMFS066C10+ GGTTTACTCGCCCGTTGACTCGCACACATGTCAGAC
JMFS094B09+ GGTTTACTCGCCCGTTGACTCGCACACATGTCAGACTCCT
JMFS054D05+ GGTTTACTCGCCCGTTGACTCGCA
JMFS037B03+ GGTTTACTCGCCCGTT
JMFS049A05+ GGTTTACTCGCCCGTTGACTCG
JMFS099F01+ GGTTTACTCGCCCGTTGACTCGCACACATGTCA
JMFS144D07+ GGTTTACTCGCCCGTTGACTCGCACACATGTCA
JMFS065F02+ GGTTTACTCGCCCGTTGACTCGCACACATGTCAGAC
JMFS116G08+ GGTTTACTCGCCCGTTGACTCGCACACATGTCAGACTCC
JMFS150H01+ GGTTTACTCGCCCGTTGACTCGCACACATGTCAGACTCCT
JMFS144H08+ GGTTTACTCGCCCGTTGACTCGCACACATGTCAGA
JMFS036H08+ GGTTTACTCGCCCGTT-ACTCGCACACATGTC
JMFF042C12+ GGTTTACTCGCCCGTTGACTCGCACACATGTCAGACTCCT
JMFS111G09+ GGTTTACTCGCCCGTTGACTCGCACACATGTCAGACTCCTTGGTCCGTGTTTCAAGACGG
JMFS094D10+ GGTTTACTCGCCCGTTGACTCGCACACATGTCAGACTCCTTGGTCCGTGTTTCAAGACGG
JMFS077A05+ ACGG
JMFS043G07+ ACGG
                      ____________________________________________________________
consensus GGTTTACTCGCCCGTTGACTCGCACACATGTCAGACTCCTTGGTCCGTGTTTCAAGACGG
 
. : . : . : . : . : . :
JMFS111G09+ GTCGAATGGAGAGCCCACAGGCCAGCGACCGGAGCGCGCAGGTGCCGAGGCACGCCAGGG
JMFS094D10+ GTCGAATGGAGAGCCCACAGGCCAGCGACCGGAGCGCGCAGGTGCCGAGGCACGCCAGGG
JMFS077A05+ GTCGAATGGAGAGCCCACAGGCCAGCGACCGGAGCGCGCAGGTGCCGAGGCACGCCAGGG
JMFS038A09+ CAGGCCAGCGACCGGAGCGCGCAGGTGCCGAGGCACGCCAGGG
JMFS043G07+ GTCGAATGGAGAGCCCACAGGCCAGCGACCGGAGCGCGCAGGTGCCGAGGCACGCCAGGG
JMFS139H10+ CAGGCCAGCGACCGGAGCGCGCAGGTGCCGAGGCACGCCAGGG
JMFS101E10+ CAGGCCAGCGACCGGAGCGCGCAGGTGCCGAGGCACGCCAGGG
JMFS085B07+ CGCGCAGGTGCCGAGGCACGCCAGGG
                      ____________________________________________________________
consensus GTCGAATGGAGAGCCCACAGGCCAGCGACCGGAGCGCGCAGGTGCCGAGGCACGCCAGGG
 
. : . : . : . : . : . :
JMFS111G09+ GCGCGCGCTGCTTCCCACGATCCAAGAGACGACGTTCCGCGGGCGTATCAAAGGCCCGGG
JMFS094D10+ GCGCGCGCTGCTTCCCACGATCCAAGAGACGACGTTCCGCGGGCGTATCAAAGGCCCGGG
JMFS077A05+ GCGCGCGCTGCTTCCCACGATCCAAGAGACGACGTTCCGCGGGCGTATCAAAGGCCCGGG
JMFS024B05+ AGACGACGTTCCGCGGGCGTATCAAAGGCCCGGG
JMFS038A09+ GCGCGCGCTGCTTCCCACGATCCAAGAGACGACGTTCCGCGGGCGTATCAAAGGCCCGGG
JMFS043G07+ GCGCGCGCTGCTTCCCACGATCCAAGAGACGACGTTCCGCGGGCGTATCAAAGGCCCGGG
JMFS139H10+ GCGCGCGCTGCTTCCCACGATCCAAGAGACGACGTTCCGCGGGCGTATCAAAGGCCCGGG
JMFS101E10+ GCGCGCGCTGCTTCCCACGATCCAAGAGACGACGTTCCGCGGGCGTATCAAAGGCCCGGG
JMFS085B07+ GCGCGCGCTGCTTCCCACGATCCAAGAGACGACGTTCCGCGGGCGTATCAAAGGCCCGGG
                      ____________________________________________________________
consensus GCGCGCGCTGCTTCCCACGATCCAAGAGACGACGTTCCGCGGGCGTATCAAAGGCCCGGG
 
. : . : . : . : . : . :
JMFS111G09+ CTTTGGCCGCCCCCCGAATCCTCGCTGGTCCGCGCCCCGAGTAGATCGGCGGACCGGCTC
JMFS094D10+ CTTTGGCCGCCCCCCGAATCCTCGCTGGTCCGCGCCCCGAGTAGATCGGCGGACCGGCTC
JMFS077A05+ CTTTGGCCGCCCCCCGAATCCTCGCTGGTCCGCGCCCCGAGTAGATCGGCGGACCGGCTC
JMFS024B05+ CTTTGGCCGCCCCCCGAATCCTCGCTGGTCCGCGCCCCGAGTAGATCGGCGGACCGGCTC
JMFS038A09+ CTTTGGCCGCCCCCCGAATCCTCGCTGGTCCGCGCCCCGAGTAGATCGGCGGACCGGCTC
JMFS043G07+ CTTTGGCCGCCCCCCGAATCCTCGCTGGTCCGCGCCCCGAGTAGATCGGCGGACCGGCTC
JMFS139H10+ CTTTGGCCGCCCCCCGAATCCTCGCTGGTCCGCGCCCCGAGTAGATCGGCGGACCGGCTC
JMFS101E10+ CTTTGGCCGCCCCCCGAATCCTCGCTGGTCCGCGCCCCGAGTAGATCGGCGGACCGGCTC
JMFS085B07+ CTTTGGCCGCCCCCCGAATCCTCGCTGGTCCGCGCCCCGAGTAGATCGGCGGACCGGCTC
                      ____________________________________________________________
consensus CTTTGGCCGCCCCCCGAATCCTCGCTGGTCCGCGCCCCGAGTAGATCGGCGGACCGGCTC
 
. : . : . : . : . : . :
JMFS111G09+ TCACCGTTCCACATACTACCGGGGCGCATCGCCGGTCTCCATCCGCTTCCCTCCCGACAA
JMFS094D10+ TCACCGTTCCACATACTACCGGGGCGCATCGCCGGTCTCCATCCGCTTCCCTCCCGACAA
JMFS077A05+ TCACCGTTCCACATACTACCGGGGCGCATCGCCGGTCTCCATCCGCTTCCCTCCCGACAA
JMFS024B05+ TCACCGTTCCACATACTACCGGGGCGCATCGCCGGTCTCCATCCGCTTCCCTCCCGACAA
JMFS038A09+ TCACCGTTCCACATACTACCGGGGCGCATCGCCGGTCTCCATCCGCTTCCCTCCCGACAA
JMFS043G07+ TCACCGTTCCACATACTACCGGGGCGCATCGCCGGTCTCCATCCGCTTCCCTCCCGACAA
JMFS139H10+ TCACCGTTCCACATACTACCGGGGCGCATCGCCGGTCTCCATCCGCTTCCCTCCCGACAA
JMFS101E10+ TCACCGTTCCACATACTACCGGGGCGCATCGCCGGTCTCCATCCGCTTCCCTCCCGACAA
JMFS101G07+ TCTCCATCCGCTTCCCTCCCGACAA
JMFS085B07+ TCACCGTTCCACATACTACCGGGGCGCATCGCCGGTCTCCATCCGCTTCCCTCCCGACAA
                      ____________________________________________________________
consensus TCACCGTTCCACATACTACCGGGGCGCATCGCCGGTCTCCATCCGCTTCCCTCCCGACAA
 
. : . : . : . : . : . :
JMFS111G09+ TTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTG
JMFS094D10+ TTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTG
JMFS077A05+ TTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTG
JMFS024B05+ TTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTG
JMFS038A09+ TTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTG
JMFS043G07+ TTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTG
JMFS139H10+ TTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTG
JMFS101E10+ TTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTG
JMFS101G07+ TTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTG
JMFS085B07+ TTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTG
                      ____________________________________________________________
consensus TTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTG
 
. : . : . : . : . : . :
JMFS111G09+ TTC
JMFS094D10+ TTCGCTATCGGTCTCTCGCCCG
JMFS077A05+ TTCGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTCACCGCCCGATTGGGGC
JMFS024B05+ TTCGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTCACCGCCCGATTGGGGC
JMFS038A09+ TTCGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTCACCGCCCGATTGGGGC
JMFS043G07+ TTCGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTCACCGCCCGATTGGGGC
JMFS139H10+ TTCGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTCACCGCCCGATTGGGGC
JMFS101E10+ TTCGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTCACCGCCCGATTGGGGC
JMFS101G07+ TTCGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTCACCGCCCGATTGGGGC
JMFS085B07+ TTCGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTCACCGCCCGATTGGGGC
                      ____________________________________________________________
consensus TTCGCTATCGGTCTCTCGCCCGTATTTAGCCTTGGACGGAATTCACCGCCCGATTGGGGC
 
. : . : . : . : . : . :
JMFS077A05+ TGCATTCCCAAACAACCCGACTCGTAGACAGCGCCTCGTGGTGCGACAGGGTCCGGGCAC
JMFS024B05+ TGCATTCCCAAACAACCCGACTCGTAGACAGCGCCTCGTGGTGCGACAGGGTCCGGGCAC
JMFS038A09+ TGCATTCCCAAACAACCCGACTCGTAGACAGCGCCTCGTGGTGCGACAGGGTCCGGGCAC
JMFS043G07+ TGCATTCCCAAACAACCCGACTCGTAGACAGCGCCTCGTGGTGCGACAGGGTCCGGGCAC
JMFS139H10+ TGCATTCCCAAACAACCCGACTCGTAGACAGCGCCTCGTGGTGCGACAGGGTCCGGGCAC
JMFS101E10+ TGCATTCCCAAACAACCCGACTCGTAGACAGCGCCTCGTGGTGCGACAGGGTCCGGGCAC
JMFS101G07+ TGCATTCCCAAACAACCCGACTCGTAGACAGCGCCTCGTGGTGCGACAGGGTCCGGGCAC
JMFS085B07+ TGCATTCCCAAACAACCCGACTCGTAGACAGCGCCTCGTGGTGCGACAGGGTCCGGGCAC
JMFF004A01+ GACTTGTAGACAGCGCCTCGTGGTGCGACAGGGTCCGGGCAC
JMFS078E05+ CCTCGTGGTGCGACAGGGTCCGGGCAC
JMFS061H12+ CGTAGACAGCGCCTCGTGGTGCGACAGGGTCCGGGCAC
JMFS073H02+ GACTCGTAGACAGCGCCTCGTGGTGCGACAGGGTCCGGGCAC
                      ____________________________________________________________
consensus TGCATTCCCAAACAACCCGACTCGTAGACAGCGCCTCGTGGTGCGACAGGGTCCGGGCAC
 
. : . : . : . : . : . :
JMFS077A05+ GACGGGGCTCTCACCCTCTCCGACGCCCCTTTCCAGGGGACTTGGGCCCGGTCCGCCGCT
JMFS024B05+ GACGGGGCTCTCACCCTCTCCGACGCCCCTTTCCAGGGGACTTGGGCCCGGTCCGCCGCT
JMFS038A09+ GACGGGGCTCTCACCCTCTCCGACGCCCCTTTCCAGGGGACTTGGGCCCGGTCCGCCGCT
JMFS043G07+ GACGGGGCTCTCACCCTCTCCGACGCCCCTTTCCAGGGGACTTGGGCCCGGTCCGCCGCT
JMFS139H10+ GACGGGGCTCTCACCCTCTCCGACGCCCCTTTCCAGGGGACTTGGGCCCGGTCCGCCGCT
JMFS101E10+ GACGGGGCTCTCACCCTCTCCGACGCCCCTTTCCAGGGGACTTGGGCCCGGTCCGCCGCT
JMFS101G07+ GACGGGGCTCTCACCCTCTCCGACGCCCCTTTCCAGGGGACTTGGGCCCGGTCCGCCGCT
JMFS085B07+ GACGGGGCTCTCACCCTCTCCGACGCCCCTTTCCAGGGGACTTGGGCCCGGTCCGCCGCT
JMFF004A01+ GACGGGGCTCTCACCCTCTCCGACGCCCCTTTCCAGGGGACTTGGGCCCGGTCCGCCGCT
JMFS078E05+ GACGGGGCTCTCACCCTCTCCGGCGCCCCTTTCCAGGGGACTTGGGCCCGGTCCGCCGCT
JMFS061H12+ GACGGGGCTCTCACCCTCTCCGACGCCCCTTTCCAGGGGACTTGGGCCCGGTCCGCCGCT
JMFS073H02+ GACGGGGCTCTCACCCTCTCCGACGCCCCTTTCCAGGGGACTTGGGCCCGGTCCGCCGCT
                      ____________________________________________________________
consensus GACGGGGCTCTCACCCTCTCCGACGCCCCTTTCCAGGGGACTTGGGCCCGGTCCGCCGCT
 
. : . : . : . : . : . :
JMFS077A05+ GAGGACGCTTCTCCAGACTACAATTCGAACGGCGGGGCCGTCCGATTCTAAGGCTGGGCT
JMFS024B05+ GAGGACGCTTCTCCAGACTACAATTCGAACGGCGGGGCCGTCCGATTCTAAGGCTGGGCT
JMFS038A09+ GAGGACGCTTCTCCAGACTACAATTCGAACGGCGGGGCCGTCCGATTCTAAGGCTGGGCT
JMFS043G07+ GAGGACGCTTCTCCAGACTACAATTCGAACGGCGGGGCCGTCCGATTCTAAGGCTGGGCT
JMFS139H10+ GAGGACGCTTCTCCAGACTACAATTCGAACGGCGGGGCCGTCCGATTCTAAGGCTGGGCT
JMFS101E10+ GAGGACGCTTCTCCAGACTACAATTCGAACGGCGGGGCCGTCCGATTCTAAGGCTGGGCT
JMFS101G07+ GAGGACGCTTCTCCAGACTACAATTCGAACGGCGGGGCCGTCCGATTCTAAGGCTGGGCT
JMFS085B07+ GAGGACGCTTCTCCAGACTACAATTCGAACGGCGGGGCCGTCCGATTCTAAGGCTGGGCT
JMFF004A01+ GAGGACGCTTCTCCAGACTACAATTCGAACGGCGGGGCCGTCCGATTCTAAGGCTGGGCT
JMFS078E05+ GAGGACGCTTCTCCAGACTACAATTCGAACGGCGGGGCCGTCCGATTCTAAGGCTGGGCT
JMFS061H12+ GAGGACGCTTCTCCAGACTACAATTCGAACGGCGGGGCCGTCCGATTCTAAGGCTGGGCT
JMFS073H02+ GAGGACGCTTCTCCAGACTACAATTCAAACGGCGGGGCCGTCCGATTCTAAGGCTGGGCT
                      ____________________________________________________________
consensus GAGGACGCTTCTCCAGACTACAATTCGAACGGCGGGGCCGTCCGATTCTAAGGCTGGGCT
 
. : . : . : . : . : . :
JMFS077A05+ GTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTAT
JMFS024B05+ GTTCCCGGTTCGCTCGCCGTTA
JMFS038A09+ GTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTAT
JMFS043G07+ GTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTAT
JMFS139H10+ GTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTAT
JMFS101E10+ GTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTAT
JMFS101G07+ GTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTAT
JMFS085B07+ GTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTAT
JMFF004A01+ GTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTAT
JMFS078E05+ GTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTAT
JMFS061H12+ GTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTAT
JMFS073H02+ GTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTAT
                      ____________________________________________________________
consensus GTTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTTTCCTCCGCTTAT
 
. : . : . : . : . : . :
JMFS077A05+ TGATATGCTTAAACTCAG
JMFS038A09+ TGATATGCTTAAACTCA
JMFS043G07+ TGATATGCTTAAACTCAGCG
JMFS139H10+ TGATATGCTTAAACTCAGCGGGTAATCCC
JMFS101E10+ TGATATGCTTAAACTCAGCGGGTAATCCCGCCTGA
JMFS101G07+ TGATATGCTTAAACTCAGCGGGTAATCCCGC
JMFS085B07+ TGATATGCTTAAACTCAGCGGGTAATCCCGCCTGA
JMFF004A01+ TGATATGCTTAAACTCAGCGGGTAATCCCGCCTGACCTGGGGTCG
JMFS078E05+ TGATATGCTTAAACTCAGCGGGTAATCCCGCCTGACCTGGGGTCGCGGTCGGAGAGCCGC
JMFS061H12+ TGATATGCTTAAACTCAGCGGGTAATCCCGCCTGACCTGGGGTCGCGGTCGGAGAGCCGC
JMFS073H02+ TGATATGCTTAAACTCAGCGGGTAATCCCGCCTGACCTGGGGTCGCGGTCGGAGAGCCGC
                      ____________________________________________________________
consensus TGATATGCTTAAACTCAGCGGGTAATCCCGCCTGACCTGGGGTCGCGGTCGGAGAGCCGC
 
. : . : . : . : . : . :
JMFS078E05+ ACTGACGCGGCTCGTCGAAGGGTCTTTCGTCCGCGGACGACGGGGGCACGGCGCGGAGAT
JMFS061H12+ ACTGACGCGGCTCGTCGAAGGGTCTTTCGCCCGCGGACGACGGGGGCACGGCGCGGAGAT
JMFS073H02+ ACTGACGCGGCTCGTCGAAGGGTCTTTCGCCCGCGGACGACGGGGGCACGGCGCGGAGAT
                      ____________________________________________________________
consensus ACTGACGCGGCTCGTCGAAGGGTCTTTCGCCCGCGGACGACGGGGGCACGGCGCGGAGAT
 
. : . : . : . : . : . :
JMFS078E05+ ATGCACGCTGGGTACGACCACCACTCGCCGTGACGTCCGCCGCCAGGGACTCGCATTTGA
JMFS061H12+ ATGCACGCTGGGTACGACCACCACTCGCCGTGACGTCCGCCGCCAGGGACTCGCATTTGA
JMFS073H02+ ATGCACGCTGGGTACGACCACCACTCGCCGTGACGTCCGCCGCCAGGGACTCGCATTTGA
                      ____________________________________________________________
consensus ATGCACGCTGGGTACGACCACCACTCGCCGTGACGTCCGCCGCCAGGGACTCGCATTTGA
 
. : . : . : . : . : . :
JMFS078E05+ GCCAGCCGCGCCCCGAGTTAGGGGAGCACGGGAGGCCACCATCCGCTCCCCAAGCTCAGC
JMFS061H12+ GCCAGCCGCGCCCCGAGTTAGGGGAGCACGGGAGGCCACCATCCGCTCCCCAAGCTCGGC
JMFS073H02+ GCCAGCCGCGCCCCGAGTTAGGGGAGCACGGGAGGCCACCATCCGCTCCCCAAGCTCGGC
                      ____________________________________________________________
consensus GCCAGCCGCGCCCCGAGTTAGGGGAGCACGGGAGGCCACCATCCGCTCCCCAAGCTCGGC
 
. : . : . : . : . : . :
JMFS078E05+ CGAGGGGCCGAGCAGGGGGGCGACGCGATGCGTGACGCCCAGGCAGACGTGCCCTCGGCC
JMFS061H12+ CGAGGGGCCGAGCAGGAGGGCGACGCGATGCGTGACGCCCAGGCAGACGTGCCCTCGGCC
JMFS073H02+ CGAGGGGCCGAGCAGGAGGGCGACGCGATGCGTGACGCCCAGGCAGACGTGCCCTCGGCC
                      ____________________________________________________________
consensus CGAGGGGCCGAGCAGGAGGGCGACGCGATGCGTGACGCCCAGGCAGACGTGCCCTCGGCC
 
. : . : . : . : . : . :
JMFS078E05+ TAACGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTC
JMFS061H12+ TAACGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTC
JMFS073H02+ TAACGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTC
                      ____________________________________________________________
consensus TAACGGCTTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCACGGGATTCTGCAATTC
 
. : . : . : . : . : . :
JMFS078E05+ ACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCGAGAGCCGAGATATCCGTTGC
JMFS061H12+ ACACCAAGTATCGCATTTCGCTACGTTCTTCATC
JMFS073H02+ ACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCGAGAGCCGAGATATCCGTTGC
                      ____________________________________________________________
consensus ACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCGAGAGCCGAGATATCCGTTGC