Previous Contig 003479:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017I03Sequence502003479 (7)gb:AK119056_18170015e-19Arabidopsis thaliana At5g21930 mRNA for putative metal-transporting ATPase, comp718009010 (3)gb:AY297817_15964962e-43Arabidopsis thaliana Paa2 P-type ATPase mRNA, complete cds; nuclear gene for chl
JMFS022F10Sequence592003479 (7)gb:AK119056_18170015e-28Arabidopsis thaliana At5g21930 mRNA for putative metal-transporting ATPase, comp
JMFS061B10Sequence626003479 (7)gb:AK119056_18170012e-37Arabidopsis thaliana At5g21930 mRNA for putative metal-transporting ATPase, comp
JMFS073G07Sequence622003479 (7)gb:AK119056_18170014e-24Arabidopsis thaliana At5g21930 mRNA for putative metal-transporting ATPase, comp
JMFS075C04Sequence641003479 (7)gb:ATT6G21_15563053e-38Arabidopsis thaliana DNA chromosome 5, BAC clone T6G21 (ESSA project).>gb:AC1409
JMFS161A05Sequence519003479 (7)gb:AY297817_15964963e-26Arabidopsis thaliana Paa2 P-type ATPase mRNA, complete cds; nuclear gene for chl
JMSF007D19Sequence337003479 (7)gb:AK119056_18170018e-09Arabidopsis thaliana At5g21930 mRNA for putative metal-transporting ATPase, comp818009010 (3)gb:AY297817_15964963e-77Arabidopsis thaliana Paa2 P-type ATPase mRNA, complete cds; nuclear gene for chl

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS161A05+ GTTCATGT
                      ____________________________________________________________
consensus GTTCATGT
 
. : . : . : . : . : . :
JMFS161A05+ CACTAGAAGCTTTCAGCCTGGCCCTTTCCTCCAGAGAACGGCCCAACAGAACAAAGCCAA
                      ____________________________________________________________
consensus CACTAGAAGCTTTCAGCCTGGCCCTTTCCTCCAGAGAACGGCCCAACAGAACAAAGCCAA
 
. : . : . : . : . : . :
JMFS161A05+ GAAGCATGACCTGCATGCGGTTCATCAAAAAATGATGCATCCCATTGAAGTTCAGGGTTA
                      ____________________________________________________________
consensus GAAGCATGACCTGCATGCGGTTCATCAAAAAATGATGCATCCCATTGAAGTTCAGGGTTA
 
. : . : . : . : . : . :
JMFS161A05+ AGAAGTGACACAGCACTAATAGCAAATGCAGCAAGTGAACCAAAGCCAACTAGAGAGTTC
                      ____________________________________________________________
consensus AGAAGTGACACAGCACTAATAGCAAATGCAGCAAGTGAACCAAAGCCAACTAGAGAGTTC
 
. : . : . : . : . : . :
JMFS161A05+ ATATTTGGCGATCTCTTCATGAATGCTTGTATACCATCAAAAAGCAGGTCTGAACTTGTG
                      ____________________________________________________________
consensus ATATTTGGCGATCTCTTCATGAATGCTTGTATACCATCAAAAAGCAGGTCTGAACTTGTG
 
. : . : . : . : . : . :
JMFS161A05+ GAAGGTATTACTGACCTCTTCCAGGCCCCAATAAAGCTCCCAAAGCCAATCCACCTTTCA
                      ____________________________________________________________
consensus GAAGGTATTACTGACCTCTTCCAGGCCCCAATAAAGCTCCCAAAGCCAATCCACCTTTCA
 
. : . : . : . : . : . :
JMFS161A05+ AATACGAATTGTGCAGTAACTCCATAATGGATCCATGACCAACATGAATGCCGAGAGAGT
JMFS061B10+ ATAATGGATCCATGACCAACATGAATGCCGAGAGAGT
JMFS075C04+ ATAATGGATGCATGCCCAACATGAATCACGAGAGACT
                      ____________________________________________________________
consensus AATACGAATTGTGCAGTAACTCCATAATGGATCCATGACCAACATGAATGCCGAGAGAGT
 
. : . : . : . : . : . :
JMFS161A05+ GAAGTATATGGGAGCCGTGAGCTCCACAACACAGAGCCACCAGCGTCCAAGCAAACGCCA
JMFS061B10+ GAAGTATATGGGAGCCGTGAGCTCCACAACACAGAGCCACCAGCGTCCAAGCAAACGCCA
JMFS075C04+ GAAGTATATGGGAGCCGTGAGCTCCACAACTCAGAGCCTCCAGCGTCCAAGCATACGCCA
JMFS022F10+ CAACACAGAGCCACCAGCGTCCAAGCAAACGCCA
                      ____________________________________________________________
consensus GAAGTATATGGGAGCCGTGAGCTCCACAACACAGAGCCACCAGCGTCCAAGCAAACGCCA
 
. : . : . : . : . : . :
JMFS161A05+ CCCGGTTCCGACTCTCCACAAGCAAACCCTCCTTCTTCGCCACCATTTCCTTCCATTTCT
JMFS061B10+ CCCGGTTCCGACTCTCCACAAGCAAACCCTCCTTCTTCGCCACCATTTCCTTCCATTTCT
JMFS075C04+ GCCGGTTCGGACTCTCCACAAGCAAACCCTCATTCTTCGCCACCATTTCCTTCCATTTCT
JMFS022F10+ CCCGGTTCCGACTCTCCACAAGCAAACCCTCCTTCTTCGCCACCATTTCCTTCCATTTCT
JMFS073G07+ TCGCCACCATTTCCTTCCATTTCT
                      ____________________________________________________________
consensus CCCGGTTCCGACTCTCCACAAGCAAACCCTCCTTCTTCGCCACCATTTCCTTCCATTTCT
 
. : . : . : . : . : . :
JMFS161A05+ TCACCTTATCTTCAATCCCAAGCCCCGACGC
JMFS061B10+ TCACCTTATCTTCAATCCCAAGCCCCGACGCTCTCCGCTTCGTCGGAAAACCACAATCCG
JMFS075C04+ TCACAGTATCTTCAATCCCGAGCCCGGACGCTCTCCGCTTCGTCGGAAAACCACAATCTG
JMFS022F10+ TCACCTTATCTTCAATCCCAAGCCCCGACGCTCTCCGCTTCGTCGGAAAACCACAATCCG
JMFF017I03+ TCAATCCCAAGCCCCGACGCTCTCCGCTTCGTCGGAAAACCACAATCCG
JMFS073G07+ TCACCTTATCTTCAATCCCAAGCCCCGACGCTCTCCGCTTCGTCGGAAAACCACAATCCG
                      ____________________________________________________________
consensus TCACCTTATCTTCAATCCCAAGCCCCGACGCTCTCCGCTTCGTCGGAAAACCACAATCCG
 
. : . : . : . : . : . :
JMFS061B10+ TCAGCCTCTTAGCTAGCTCTTCAGCAGCGCTTCCCTCCTCCACAGCGGCGGCGGCGGTCG
JMFS075C04+ TCAGCCTCTTAGCTAGCTCTTCAGCAGCGCTTCCCTCCTCCACAGCGGCGGCGGCGGTGG
JMFS022F10+ TCAGCCTCTTAGCTAGCTCTTCAGCAGCGCTTCCCTCCTCCACAGCGGCGGCGGCGGTCG
JMFF017I03+ TCAGCCTCTTAGCTAGCTCTTCAGCAGCGCTTCCCTCCTCCACAGCGGCGGCGGCGGTCG
JMFS073G07+ TCAGCCTCTTAGCTAGCTCTTCAGCAGCGCTTCCCTCCTCCACAGCGGCGGCGGCGGTCG
                      ____________________________________________________________
consensus TCAGCCTCTTAGCTAGCTCTTCAGCAGCGCTTCCCTCCTCCACAGCGGCGGCGGCGGTCG
 
. : . : . : . : . : . :
JMFS061B10+ GCTTCAGCTTCACCGCGGCCGTCTCCGTCAACATGTTGACCACGGCCGACTCGACTCTGT
JMFS075C04+ GCTTCAGCTTCACCGCGGCGGTCTCCGTCAACATGTTGGCCACGGCCGACTCGACTCTGT
JMFS022F10+ GCTTCAGCTTCACCGCGGCCGTCTCCGTCAACATGTTGACCACGGCCGACTCGACTCTGT
JMFF017I03+ GCTTCAGCTTCACCGCGGCCGTCTCCGTCAACATGTTGACCACGGCCGACTCGACTCTGT
JMSF007D19+ TGT
JMFS073G07+ GCTTCAGCTTCACCGCGGCCGTCTCCGTCAACATGTTGACCACGGCCGACTCGACTCTGT
                      ____________________________________________________________
consensus GCTTCAGCTTCACCGCGGCCGTCTCCGTCAACATGTTGACCACGGCCGACTCGACTCTGT
 
. : . : . : . : . : . :
JMFS061B10+ CGTCGGCGGAAAGGATCGATTTGACGCGTGAGACGCACGCGCCGCACATCATCCCCGTCA
JMFS075C04+ CGTCGGCGGAAAGGATCGATTTGACGCGTGAGACGCACGCGCCGCACATCATCCCCGTCA
JMFS022F10+ CGTCGGCGGAAAGGATCGATTTGACGCGTGAGACGCACGCGCCGCACATCATCCCCGTCA
JMFF017I03+ CGTCGGCGGAAAGGATCGATTTGACGCGTGAGACGCACGCGCCGCACATCATCCCCGTCA
JMSF007D19+ CGTCGGCGGAAAGGATCGATTTGACGCGTGAGACGCACGCGCCGCACATCATCCCCGTCA
JMFS073G07+ CGTCGGCGGAAAGGATCGATTTGACGCGTGAGACGCACGCGCCGCACATCATCCCCGTCA
                      ____________________________________________________________
consensus CGTCGGCGGAAAGGATCGATTTGACGCGTGAGACGCACGCGCCGCACATCATCCCCGTCA
 
. : . : . : . : . : . :
JMFS061B10+ CATCCAGAAGCACAGTTGTGTCGTCCGGCTTCGCTTGCTTCTGAACCGGCTCCGTAGACG
JMFS075C04+ CATCCAGAAGCTCAGTTGTGTCGT--GGCTTCGCTTGCTTCTGAACCGGCTCCGTAGACG
JMFS022F10+ CATCCAGAAGCACAGTTGTGTCGTCCGGCTTCGCTTGCTTCTGAACCGGCTCCGTAGACG
JMFF017I03+ CATCCAGAAGCACAGTTGTGTCGTCCGGCTTCGCTTGCTTCTGAACCGGCTCCGTAGACG
JMSF007D19+ CATCCAGAAGCACAGTTGTGTCGTCCGGCTTCGCTTGCTTCTGAACCGGCTCCGTAGACG
JMFS073G07+ CATCCAGAAGCACAGTTGTGTCGTCCGGCTTCGCTTGCTTCTGAACCGGCTCCGTAGACG
                      ____________________________________________________________
consensus CATCCAGAAGCACAGTTGTGTCGTCCGGCTTCGCTTGCTTCTGAACCGGCTCCGTAGACG
 
. : . : . : . : . : . :
JMFS061B10+ CGGGTTTGACCTCAAC-TGCCTTGGCGAAGACGCCATTGCGGAGCAATTGGGGATCGGTG
JMFS075C04+ CGGGTTTGACCTCACCTTGCCTTGGCGAAGACGCCATTGCGGAGCAATTGGGGATCGGTG
JMFS022F10+ CGGGTTTGACCTCAAC-TGCCTTGGCGAAGACGCCATTGCGGAGCAATTGGGGATCGGTG
JMFF017I03+ CGGGTTTGACCTCAAC-TGCCTTGGCGAAGACGCCATTGCGGAGCAATTGGGGATCGGTG
JMSF007D19+ CGGGTTTGACCTCAAC-TGCCTTGGCGAAGACGCCATTGCGGAGCAATTGGGGATCGGTG
JMFS073G07+ CGGGTTTGACCTCAAC-TGCCTTGGCGAAGACGCCATTGCGGAGCAATTGGGGATCGGTG
                      ____________________________________________________________
consensus CGGGTTTGACCTCAAC-TGCCTTGGCGAAGACGCCATTGCGGAGCAATTGGGGATCGGTG
 
. : . : . : . : . : . :
JMFS061B10+ CGGCGTTGTCTGCGGAGGAGAGGATTGAGCTGAAAATTCCTGACATTGGAGTAGTGGAAG
JMFS075C04+ CGGCGTTGTCTCCGGAGGAGAGGATTGAGCTGAAAATTCCTGACATTGGAGTAGTGGAAG
JMFS022F10+ CGGCGTTGTCTGCGGAGGAGAGGATTGAGCTGAAAATTCCTGACATTGGAGTAGTGGAAG
JMFF017I03+ CGGCGTTGTCTGCGGAGGAGAGGATTGAGCTGAAAATTCCTGACATTGGAGTAGTGGAAG
JMSF007D19+ CGGCGTTGTCTGCGGAGGAGAGGATTGAGCTGAAAATTCCTGACATTGGAGTAGTGGAAG
JMFS073G07+ CGGCGTTGTCTGCGGAGGAGAGGATTGAGCTGAAAATTCCTGACATTGGAGTAGTGGAAG
                      ____________________________________________________________
consensus CGGCGTTGTCTGCGGAGGAGAGGATTGAGCTGAAAATTCCTGACATTGGAGTAGTGGAAG
 
. : . : . : . : . : . :
JMFS061B10+ CTCGGGGTGAGCTT-CTGGTTCGGGGAGAGTGAAAATCGAAGGA
JMFS075C04+ CTCGGGGTGAGCTTCCTGGTTCGGGGAGAGTGAAAATCGAAGGAGATTGGCCGCCATGGC
JMFS022F10+ CTCGGGGTGAGCTT-CTGGTTCGGGGAGAGTGAAAATCGAAGGAGATTCGCCGCCATGGC
JMFF017I03+ CTCGGGGTGAGCTT-CTGGTTCGGGGAGAGTGAAAATCGAAGGAGATTCGCCGCCATGGC
JMSF007D19+ CTCGGGGTGAGCTT-CTGGTTCGGGGAGAGTGAAAATCGAAGGAGATTCGCCGCCATGGC
JMFS073G07+ CTCGGGGTGAGCTT-CTGGTTCGGGGAGAGTGAAAATCGAAGGAGATTCGCCGCCATGGC
                      ____________________________________________________________
consensus CTCGGGGTGAGCTT-CTGGTTCGGGGAGAGTGAAAATCGAAGGAGATTCGCCGCCATGGC
 
. : . : . : . : . : . :
JMFS075C04+ TTGCCG
JMFS022F10+ TTGCCGGAAATGAGGTCCCG
JMFF017I03+ TTGCCGGAAATGAGGTCCCGATTGACCGGAAAAAT
JMSF007D19+ TTGCCGGAAATGAGGTCCCGATTGACCGGAAAAAT
JMFS073G07+ TTGCCGGAAATGAGGTCCCGATTGACCGGAAAAATGAAGTTTAGGCGTTTCTTGGTCTAT
                      ____________________________________________________________
consensus TTGCCGGAAATGAGGTCCCGATTGACCGGAAAAATGAAGTTTAGGCGTTTCTTGGTCTAT
 
. : . : . : . : . : . :
JMFS073G07+ TTATGACCGGTAATAAGAAACACGTCGCCACGCTGGCATTATTGCCAATTTCTCATGAAG
                      ____________________________________________________________
consensus TTATGACCGGTAATAAGAAACACGTCGCCACGCTGGCATTATTGCCAATTTCTCATGAAG