Previous Contig 003478:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS073F09Sequence627003478 (2)gb:AF120153_17697595e-10Arabidopsis thaliana cyclin-dependent kinase CDC2C (CDC2CAt) mRNA, complete cds.
JMFS143E02Sequence626003478 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS143E02+ GCGCCTATTCAAGTTAAACATCTCTGC
                      ____________________________________________________________
consensus GCGCCTATTCAAGTTAAACATCTCTGC
 
. : . : . : . : . : . :
JMFS143E02+ AGAAACGTGATCTTCGAACTGATTGAGCTGCCTGGCCATCCTGCCTTTTATGTCCCCGGT
                      ____________________________________________________________
consensus AGAAACGTGATCTTCGAACTGATTGAGCTGCCTGGCCATCCTGCCTTTTATGTCCCCGGT
 
. : . : . : . : . : . :
JMFS143E02+ ATGTTAATGGTCCTGAGAACGCCCGCCCATCAGAGTCTACTGATTGCTCGCGTGAATGAT
                      ____________________________________________________________
consensus ATGTTAATGGTCCTGAGAACGCCCGCCCATCAGAGTCTACTGATTGCTCGCGTGAATGAT
 
. : . : . : . : . : . :
JMFS143E02+ ATAAATCGGGTGACAGAAAAGGCGGTGGTTGTTCCTCCACTGATAACTCCTTTGAGAAGT
                      ____________________________________________________________
consensus ATAAATCGGGTGACAGAAAAGGCGGTGGTTGTTCCTCCACTGATAACTCCTTTGAGAAGT
 
. : . : . : . : . : . :
JMFS143E02+ GATATATATCTGGCGAGTGGAACGACAAAGGTTGCTCCACCTGCTTCATACTCTTCGGCC
JMFS073F09+ GCTCCACCTGCTTCATACTCTTCGGCC
                      ____________________________________________________________
consensus GATATATATCTGGCGAGTGGAACGACAAAGGTTGCTCCACCTGCTTCATACTCTTCGGCC
 
. : . : . : . : . : . :
JMFS143E02+ GAATAGCCAAGCCACCGTCTTGCTCATCTAAGCCCAATGGGTCGTCTTTGGACTGCTGCA
JMFS073F09+ GAATAGCCAAGCCACCGTCTTGCTCATCTAAGCCCAATGGGTCGTCTTTGGACTGCTGCA
                      ____________________________________________________________
consensus GAATAGCCAAGCCACCGTCTTGCTCATCTAAGCCCAATGGGTCGTCTTTGGACTGCTGCA
 
. : . : . : . : . : . :
JMFS143E02+ ACGTGGGGGGTTCTACACCACCGTTCATTGTTATGCTTCTCGAATTGGCGAAAGCATGGA
JMFS073F09+ ACGTGGGGGGTTCTACACCACCGTTCATTGTTATGCTTCTCGAATTGGCGAAAGCATGGA
                      ____________________________________________________________
consensus ACGTGGGGGGTTCTACACCACCGTTCATTGTTATGCTTCTCGAATTGGCGAAAGCATGGA
 
. : . : . : . : . : . :
JMFS143E02+ ATCTTGCGGCTGCGCGTTCGTGCTTCTTTGGCCATCCATAACTGCTCGATGAGATCATTT
JMFS073F09+ ATCTTGCGGCTGCGCGTTCGTGCTTCTTTGGCCATCCATAACTGCTCGATGAGATCATTT
                      ____________________________________________________________
consensus ATCTTGCGGCTGCGCGTTCGTGCTTCTTTGGCCATCCATAACTGCTCGATGAGATCATTT
 
. : . : . : . : . : . :
JMFS143E02+ GTGCGGGGACCGAGCAAATGCTGTCCCCTTGAGACACCTCGGTTGCAGTCTGGGAGGCTG
JMFS073F09+ GTGCGGGGACCGAGCAAATGCTGTCCCCTTGAGACACCTCGGTTGCAGTCTGGGAGGCTG
                      ____________________________________________________________
consensus GTGCGGGGACCGAGCAAATGCTGTCCCCTTGAGACACCTCGGTTGCAGTCTGGGAGGCTG
 
. : . : . : . : . : . :
JMFS143E02+ CCTCCGACACGGTATCATAAGATGATTTCAGTGACATCCGTGCCACAGTGGCGCCTCTAG
JMFS073F09+ CCTCCGACACGGTATCATAAGATGATTTCAGTGACATCCGTGCCACAGTGGCGCCTCTAG
                      ____________________________________________________________
consensus CCTCCGACACGGTATCATAAGATGATTTCAGTGACATCCGTGCCACAGTGGCGCCTCTAG
 
. : . : . : . : . : . :
JMFS143E02+ AACCGCTACCATTGCCTCTACGAGAGCCAAGCATGTTGGCCTCCACCTCCTCAGTGGGA
JMFS073F09+ AACCGCTACCATTGCCTCTACGAGAGCCAAGCATGTTGGCCTCCACCTCCTCAGTGGGAG
                      ____________________________________________________________
consensus AACCGCTACCATTGCCTCTACGAGAGCCAAGCATGTTGGCCTCCACCTCCTCAGTGGGAG
 
. : . : . : . : . : . :
JMFS073F09+ CCATTCCTTTTCGAAGTCTTCTCATATTTCTTGAAGATCCAGATCCCCTTACAGCGGAAC
                      ____________________________________________________________
consensus CCATTCCTTTTCGAAGTCTTCTCATATTTCTTGAAGATCCAGATCCCCTTACAGCGGAAC
 
. : . : . : . : . : . :
JMFS073F09+ CAGCCTTCCTTCTCCTAGCTTCTTCGCGGAATTTTGCATCAATCTCTCTGTTTGGTGGGA
                      ____________________________________________________________
consensus CAGCCTTCCTTCTCCTAGCTTCTTCGCGGAATTTTGCATCAATCTCTCTGTTTGGTGGGA
 
. : . : . : . : . : . :
JMFS073F09+ ATTTTGGCATGCTTGATGGATCACAAGCATAGGGCTTCGTATGGAAATACTCGGAATTAA
                      ____________________________________________________________
consensus ATTTTGGCATGCTTGATGGATCACAAGCATAGGGCTTCGTATGGAAATACTCGGAATTAA
 
. : . : . : . : . : . :
JMFS073F09+ GAGAAGATGAAGCTGTTCCACCTTATAGAAACGCTTCTCTCGATAGAGCCTTATAAGCGT
                      ____________________________________________________________
consensus GAGAAGATGAAGCTGTTCCACCTTATAGAAACGCTTCTCTCGATAGAGCCTTATAAGCGT