Previous Contig 003477:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007P08Sequence561003477 (6)gb:BT003850_16369782e-38Arabidopsis thaliana clone RAFL15-48-D07 (R20842) putative VAMP protein SEC22 (A654003477 (6)gb:BT003850_16369784e-42Arabidopsis thaliana clone RAFL15-48-D07 (R20842) putative VAMP protein SEC22 (A
JMFF041L08Sequence655003477 (6)gb:BT003850_16369787e-54Arabidopsis thaliana clone RAFL15-48-D07 (R20842) putative VAMP protein SEC22 (A542010156 (8)sp|Q40412|ABA2_NICPL2e-35Zeaxanthin epoxidase, chloroplast precursor (EC 1.14.-.-).>pir|S69548|S69548 zea
JMFN040K04Sequence562003477 (6)gb:BT003850_16369786e-33Arabidopsis thaliana clone RAFL15-48-D07 (R20842) putative VAMP protein SEC22 (A
JMFN044M18Sequence633003477 (6)gb:BT003850_16369781e-54Arabidopsis thaliana clone RAFL15-48-D07 (R20842) putative VAMP protein SEC22 (A
JMFS073F05Sequence618003477 (6)gb:BT003850_16369786e-54Arabidopsis thaliana clone RAFL15-48-D07 (R20842) putative VAMP protein SEC22 (A

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN040K04+ TAAC
rJMFF007P08- TATTTGTCATCCCATCCTTAAC
                      ____________________________________________________________
consensus TATTTGTCATCCCATCCTTAAC
 
. : . : . : . : . : . :
JMFN040K04+ CTTGCTTACATCATTGTATATTTTGCTGTCACTTCCTCGTCGTTATTTTTGTTTTTCTTT
rJMFF007P08- CTTGCTTACATCATTGTATATTTTGCTGTCACTTCCTCGTCGTTATTTTTGTTTTTCTTT
                      ____________________________________________________________
consensus CTTGCTTACATCATTGTATATTTTGCTGTCACTTCCTCGTCGTTATTTTTGTTTTTCTTT
 
. : . : . : . : . : . :
JMFN040K04+ TTTAAATAGCAAAATCTACAATTATTTTTCACCTGTATTCTGGGCACTTTGGCAGTGGGG
rJMFF007P08- TTTAAATAGCAAAATCTACAATTATTTTTCACCTGTATTCTGGGCACTTTGGCAGTGGGG
                      ____________________________________________________________
consensus TTTAAATAGCAAAATCTACAATTATTTTTCACCTGTATTCTGGGCACTTTGGCAGTGGGG
 
. : . : . : . : . : . :
JMFN040K04+ TAAAATGATAAATAATAAAAGTAAAAACAGGGAAAATGATCATGACTGTAGTAAATACTT
rJMFF007P08- TAAAATGATAAATAATAAAAGTAAAAACAGGGAAAATGATCATGACTGTAGTAAATACTT
                      ____________________________________________________________
consensus TAAAATGATAAATAATAAAAGTAAAAACAGGGAAAATGATCATGACTGTAGTAAATACTT
 
. : . : . : . : . : . :
JMFN040K04+ GACGGCGCGGCGACGTTGACTTGACGATTAAAGGCTAACGTCGCAGCTCGAGACGAGCTG
rJMFF007P08- GACGGCGCGGCGACGTTGACTTGACGATTAAAGGCTAACGTCGCAGCTCGAGACGAGCTG
                      ____________________________________________________________
consensus GACGGCGCGGCGACGTTGACTTGACGATTAAAGGCTAACGTCGCAGCTCGAGACGAGCTG
 
. : . : . : . : . : . :
JMFN040K04+ GTATTTCACGGCGTTGCCGACGACGATGCCGCCGGGTCTGGGAGTGTCTCCGAACGGAAT
rJMFF007P08- GTATTTCACGGCGTTGCCGACGACGATGCCGCCGGGTCTGGGAGTGTCTCCGAACGGAAT
JMFF041L08+ GTGTCTCCGAACGGAAT
JMFN044M18+ GAACGGAAT
JMFS073F05+ GTGTCTCCGAACGGAAT
                      ____________________________________________________________
consensus GTATTTCACGGCGTTGCCGACGACGATGCCGCCGGGTCTGGGAGTGTCTCCGAACGGAAT
 
. : . : . : . : . : . :
JMFN040K04+ ATAGGCCGGACAAGTGACGTGGATATGGTAGCGGCTAGTGACCAGGGTCCCGACTTTCCA
rJMFF007P08- ATAGGCCGGACAAGTGACGTGGATATGGTAGCGGCTAGTGACCAGGGTCCCGACTTTCCA
JMFF041L08+ ATAGGCCGGACAAGTGACGTGGATATGGTAGCGGCTAGTGACCAGGGTCCCGACTTTCCA
JMFN044M18+ ATAGGCCGGACAAGTGACGTGGATATGGTAGCGGCTAGTGACCAGGGTCCCGACTTTCCA
JMFS073F05+ ATAGGCCGGACAAGTGACGTGGATATGGTAGCGGCTAGTGACCAGGGTCCCGACTTTCCA
                      ____________________________________________________________
consensus ATAGGCCGGACAAGTGACGTGGATATGGTAGCGGCTAGTGACCAGGGTCCCGACTTTCCA
 
. : . : . : . : . : . :
JMFN040K04+ CCTAATGCGTCCGTCGAGGCGGAAGATGAGCCAGACGCCGCCGTCGGCCTGGGCGGCGCT
rJMFF007P08- CCTAATGCGTCCGTCGAGGCGGAAGATGAGCCAGACGCCGCCGTCGGCCTGGGCGGCGCT
JMFF007P08+ TCGAGGCGGAAGATGAGCCAGACGCCGCCGTCGGCCTGGGCGGCGCT
JMFF041L08+ CCTAATGCGTCCGTCGAGGCGGAAGATGAGCCAGACGCCGCCGTCGGCCTGGGCGGCGCT
JMFN044M18+ CCTAATGCGTCCGTCGAGGCGGAAGATGAGCCAGACGCCGCCGTCGGCCTGGGCGGCGCT
JMFS073F05+ CCTAATGCGTCCGTCGAGGCGGAAGATGAGCCAGACGCCGCCGTCGGCCTGGGCGGCGCT
                      ____________________________________________________________
consensus CCTAATGCGTCCGTCGAGGCGGAAGATGAGCCAGACGCCGCCGTCGGCCTGGGCGGCGCT
 
. : . : . : . : . : . :
JMFN040K04+ GAGCATAGGGCCGAAGAAGGGCGCAATGGGGACGTCGTTGCCGTAGACGAACGGAGACCA
rJMFF007P08- GAGCATAGGGCCGAANAAGGGCGCAATGGGGACGTCGTTGCCGTANACGAACGGAGACCA
JMFF007P08+ GAGCATAGGGCCGAAGAAGGGCGCAATGGGGACGTCGTTGCCGTAGACGAACGGAGACCA
JMFF041L08+ GAGCATAGGGCCGAAGAAGGGCGCAATGGGGACGTCGTTGCCGTAGACGAACGGAGACCA
JMFN044M18+ GAGCATAGGGCCGAAGAAGGGCGCAATGGGGACGTCGTTGCCGTAGACGAACGGAGACCA
JMFS073F05+ GAGCATAGGGCCGAAGAAGGGCGCAATGGGGACGTCGTTGCCGTAGACGAACGGAGACCA
                      ____________________________________________________________
consensus GAGCATAGGGCCGAAGAAGGGCGCAATGGGGACGTCGTTGCCGTAGACGAACGGAGACCA
 
. : . : . : . : . : . :
JMFN040K04+ GACGTTGCGGTCCTTGTGGCCCTGGTATACCGGCGGGATAGCGGTGGAATAGGTGATTTG
rJMFF007P08- NACGTTGCGGTCCTTGTGGCCCTGGTATACCGGCGGGATAGCGGTGGAATAGGTGATTTG
JMFF007P08+ GACGTTGCGGTCCTTGTGGCCCTGGTATACCGGCGGGATAGCGGTGGAATAGGTGATTTG
JMFF041L08+ GACGTTGCGGTCCTTGTGGCCCTGGTATACCGGCGGGATAGCGGTGGAATAGGTGATTTG
JMFN044M18+ GACGTTGCGGTCCTTGTGGCCCTGGTATACCGGCGGGATAGCGGTGGAATAGGTGATTTG
JMFS073F05+ GACGTTGCGGTCCTTGTGGCCCTGGTATACCGGCGGGATAGCGGTGGAATAGGTGATTTG
                      ____________________________________________________________
consensus GACGTTGCGGTCCTTGTGGCCCTGGTATACCGGCGGGATAGCGGTGGAATAGGTGATTTG
 
. : . : . : . : . : . :
JMFN040K04+ CTGGCCGCGGAAGGTGGC
rJMFF007P08- CTGGCCGCGGAAGGTGGCGAAGGTACCGAGCCGGTCGTANTAAATCCCGATCTTGTCGTT
JMFF007P08+ CTGGCCGCGGAAGGTGGCGAAGGTACCGAGCCGGTCGTAGTAAATCCCGATCTTGTCGTT
JMFF041L08+ CTGGCCGCGGAAGGTGGCGAAGGTACCGAGCCGGTCGTAGTAAATCCCGATCTTGTCGTT
JMFN044M18+ CTGGCCGCGGAAGGTGGCGAAGGTACCGAGCCGGTCGTAGTAAATCCCGATCTTGTCGTT
JMFS073F05+ CTGGCCGCGGAAGGTGGCGAAGGTACCGAGCCGGTCGTAGTAAATCCCGATCTTGTCGTT
                      ____________________________________________________________
consensus CTGGCCGCGGAAGGTGGCGAAGGTACCGAGCCGGTCGTAGTAAATCCCGATCTTGTCGTT
 
. : . : . : . : . : . :
rJMFF007P08- GGGGTTGCGGGAGGTGACGGTGATTTGGATGG
JMFF007P08+ GGGGTTGCGGGAGGTGACGGTGATTTGGATGGTGGCGGAGAGGATGTTGGGGGCGGAGAC
JMFF041L08+ GGGGTTGCGGGAGGTGACGGTGATTTGGATGGTGGCGGAGAGGATGTTGGGGGCGGAGAC
JMFN044M18+ GGGGTTGCGGGAGGTGACGGTGATTTGGATGGTGGCGGAGAGGATGTTGGGGGCGGAGAC
JMFS073F05+ GGGGTTGCGGGAGGTGACGGTGATTTGGATGGTGGCGGAGAGGATGTTGGGGGCGGAGAC
                      ____________________________________________________________
consensus GGGGTTGCGGGAGGTGACGGTGATTTGGATGGTGGCGGAGAGGATGTTGGGGGCGGAGAC
 
. : . : . : . : . : . :
JMFF007P08+ GTTGAAGTTGAAGATGGTGGCGTCCTGGAGGAGGAAGGTGGGCTTCTTGGGCTGGAGAAC
JMFF041L08+ GTTGAAGTTGAAGATGGTGGCGTCCTGGAGGAGGAAGGTGGGCTTCTTGGGCTGGAGAAC
JMFN044M18+ GTTGAAGTTGAAGATGGTGGCGTCCTGGAGGAGGAAGGTGGGCTTCTTGGGCTGGAGAAC
JMFS073F05+ GTTGAAGTTGAAGATGGTGGCGTCCTGGAGGAGGAAGGTGGGCTTCTTGGGCTGGAGAAC
                      ____________________________________________________________
consensus GTTGAAGTTGAAGATGGTGGCGTCCTGGAGGAGGAAGGTGGGCTTCTTGGGCTGGAGAAC
 
. : . : . : . : . : . :
JMFF007P08+ CGCCCAGATGATGAGGATGGTGAGGAGGACGAGGAAGAGGA
JMFF041L08+ CGCCCAGATGATGAGGATGGTGAGGAGGACGAGGAAGAGGA
JMFN044M18+ CGCCCAGATGATGAGGATGGTGAGGAGGACGAGGAAGAGGA
JMFS073F05+ CGCCCAGATGATGAGGATGGTGAGGAGGACGAGGAAGAGGAAGATGAGAAGCCCGGCGCA
                      ____________________________________________________________
consensus CGCCCAGATGATGAGGATGGTGAGGAGGACGAGGAAGAGGAAGATGAGAAGCCCGGCGCA
 
. : . : . : . : . : . :
JMFS073F05+ GCACTGCCGAGTTCGCTTCTTTTTCCGTTCCTTGTGGTGGGTGCACTCCTTCGTAGACAT
                      ____________________________________________________________
consensus GCACTGCCGAGTTCGCTTCTTTTTCCGTTCCTTGTGGTGGGTGCACTCCTTCGTAGACAT
 
. : . : . : . : . : . :
JMFS073F05+ GGTTTTCCGGCGGCGGCGGCGGCGGGCGGTGGAGAGGGAGTGGTTGTTAGGTGAGAGAAC
                      ____________________________________________________________
consensus GGTTTTCCGGCGGCGGCGGCGGCGGGCGGTGGAGAGGGAGTGGTTGTTAGGTGAGAGAAC