Previous Contig 003474:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS073E07Sequence616003474 (3)gb:BA000042_16324751e-50Nicotiana tabacum mitochondrial DNA, complete genome.>gb:BA000042_1632602 Nicoti
JMFS091E08Sequence621003474 (3)gb:AE016798_3352505e-06Vibrio vulnificus CMCP6 chromosome I section 2 of 11 of the complete sequence.>g
JMFS153H05Sequence614003474 (3)gb:AE016800_3359041e-05Vibrio vulnificus CMCP6 chromosome I section 4 of 11 of the complete sequence.>g

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS153H05+ TGGGGTTGGTAAGGCGAAATGGGGCCACCCTAG
                      ____________________________________________________________
consensus TGGGGTTGGTAAGGCGAAATGGGGCCACCCTAG
 
. : . : . : . : . : . :
JMFS153H05+ CCCATTGAGTGCTCTACCTCGGGCCATCGACATCATACGCTCTACTGAAATAGATTTCGC
JMFS091E08+ GGCCATCGACATCATACGCTCTACTGAAATAGATTTCGC
                      ____________________________________________________________
consensus CCCATTGAGTGCTCTACCTCGGGCCATCGACATCATACGCTCTACTGAAATAGATTTCGC
 
. : . : . : . : . : . :
JMFS153H05+ GGAAAACCAGCTATATCCGATCTTGGTTGGCCTTTCACCCCTAGCCACAAGTCATCCCCG
JMFS091E08+ GGAAAACCAGCTATATCCGATCTTGGTTGGCCTTTCACCCCTAGCCACAAGTCATCCCCG
                      ____________________________________________________________
consensus GGAAAACCAGCTATATCCGATCTTGGTTGGCCTTTCACCCCTAGCCACAAGTCATCCCCG
 
. : . : . : . : . : . :
JMFS153H05+ TATTTTGCCACATACGTGGGTTCGGTCCTCCAAGGCCTGTTAGAGCTCTCTTCAACCTGC
JMFS091E08+ TATTTTGCCACATACGTGGGTTCGGTCCTCCAAGGCCTGTTAGAGCTCTCTTCAACCTGC
                      ____________________________________________________________
consensus TATTTTGCCACATACGTGGGTTCGGTCCTCCAAGGCCTGTTAGAGCTCTCTTCAACCTGC
 
. : . : . : . : . : . :
JMFS153H05+ TCATGGCTAGATCGATCGGTTTCGGGTCAAATAGGAAGAACTAGAAGATTCCACCTCTGG
JMFS091E08+ TCATGGCTAGATCGATCGGTTTCGGGTCAAATAGGAAGAACTAGAAGATTCCACCTCTGG
                      ____________________________________________________________
consensus TCATGGCTAGATCGATCGGTTTCGGGTCAAATAGGAAGAACTAGAAGATTCCACCTCTGG
 
. : . : . : . : . : . :
JMFS153H05+ AAAGCGCCTACACCTAATGGCTTAAGCCGCTGTTCCCATTTCCTCGCTGACCCATCATGC
JMFS091E08+ AAAGCGCCTACACCTAATGGCTTAAGCCGCTGTTCCCATTTCCTCGCTGACCCATCATGC
                      ____________________________________________________________
consensus AAAGCGCCTACACCTAATGGCTTAAGCCGCTGTTCCCATTTCCTCGCTGACCCATCATGC
 
. : . : . : . : . : . :
JMFS153H05+ AAAAGGTACGCCGTTAGAGTGAGTGCGCTTTACATAAAGTAAAGGCTCTAAGCTCCGCTC
JMFS091E08+ AAAAGGTACGCCGTTAGAGTGAGTGCGCTTTACATAAAGTAAAGGCTCTAAGCTCCGCTC
                      ____________________________________________________________
consensus AAAAGGTACGCCGTTAGAGTGAGTGCGCTTTACATAAAGTAAAGGCTCTAAGCTCCGCTC
 
. : . : . : . : . : . :
JMFS153H05+ CTTCGACTGATTGTTCGCATCGGATCTCAGGTTCTCTATTGCACTCCCTAAATAGGGTTC
JMFS091E08+ CTTCGACTGATTGTTCGCATCGGATCTCAGGTTCTCTATTGCACTCCCTAAATAGGGTTC
                      ____________________________________________________________
consensus CTTCGACTGATTGTTCGCATCGGATCTCAGGTTCTCTATTGCACTCCCTAAATAGGGTTC
 
. : . : . : . : . : . :
JMFS153H05+ TTTTCACCTTTCCCTCACGGTACTTGTACGCTATCGGTCATTGAGGAATACTTAGGCTTA
JMFS091E08+ TTTTCACCTTTCCCTCACGGTACTTGTACGCTATCGGTCATTGAGGAATACTTAGGCTTA
                      ____________________________________________________________
consensus TTTTCACCTTTCCCTCACGGTACTTGTACGCTATCGGTCATTGAGGAATACTTAGGCTTA
 
. : . : . : . : . : . :
JMFS153H05+ GAGGGTGGTCCCCCTTTCTCGCGTAAAAGCGATCAGAATTCGAACACGCCGCGTTTTACT
JMFS091E08+ GAGGGTGGTCCCCCTTTCTCGCGTAAAAGCGATCAGAATTCGAACACGCCGCGTTTTACT
                      ____________________________________________________________
consensus GAGGGTGGTCCCCCTTTCTCGCGTAAAAGCGATCAGAATTCGAACACGCCGCGTTTTACT
 
. : . : . : . : . : . :
JMFS153H05+ GGGAAGGATCGAACCATGGGAACGAATCTACAGGGCTATCA
JMFS091E08+ GGGAAGGATCGAACCATGGGAACGAATCTACAGGGCTATCACCTTCTTTGGCCAGATCTT
JMFS073E07+ TCTTTGGCCAGATCTT
                      ____________________________________________________________
consensus GGGAAGGATCGAACCATGGGAACGAATCTACAGGGCTATCACCTTCTTTGGCCAGATCTT
 
. : . : . : . : . : . :
JMFS091E08+ CCAATCTTTTCACAATTACAGTTCACTGCGCCCGCTCCTTCT
JMFS073E07+ CCAATCTTTTCACAATTACAGTTCACTGCGCCCGCTCCTTCTAGTGTTGGGCGGCGGCTT
                      ____________________________________________________________
consensus CCAATCTTTTCACAATTACAGTTCACTGCGCCCGCTCCTTCTAGTGTTGGGCGGCGGCTT
 
. : . : . : . : . : . :
JMFS073E07+ GAAAGCTTACCTTATTAGAAAGGTTTCCTAGTTTTGGATTTTTGAGTTTTCGCCCCAACC
                      ____________________________________________________________
consensus GAAAGCTTACCTTATTAGAAAGGTTTCCTAGTTTTGGATTTTTGAGTTTTCGCCCCAACC
 
. : . : . : . : . : . :
JMFS073E07+ TAGGCTAGGGGGTCGTTAGACCGTAGCTTGCTGCTGAAAAACGTAATAGGCTAGCGCGGC
                      ____________________________________________________________
consensus TAGGCTAGGGGGTCGTTAGACCGTAGCTTGCTGCTGAAAAACGTAATAGGCTAGCGCGGC
 
. : . : . : . : . : . :
JMFS073E07+ TCGCTTCGCTCTTCAAGCTCCGCCCCCCTTACTCAACCTCAACATCTATAAAAAAGCCCT
                      ____________________________________________________________
consensus TCGCTTCGCTCTTCAAGCTCCGCCCCCCTTACTCAACCTCAACATCTATAAAAAAGCCCT
 
. : . : . : . : . : . :
JMFS073E07+ TGATTTAGAATAAGGTAAGCTTTGAAGCCGTAGCTTGCTGGTTTTTCCATCATCCAATCC
                      ____________________________________________________________
consensus TGATTTAGAATAAGGTAAGCTTTGAAGCCGTAGCTTGCTGGTTTTTCCATCATCCAATCC
 
. : . : . : . : . : . :
JMFS073E07+ ACAACAAATCGAATGAAACCTGGCGAAAAAGAAGTGAACACTTTGCTGAGGAACGAAGCT
                      ____________________________________________________________
consensus ACAACAAATCGAATGAAACCTGGCGAAAAAGAAGTGAACACTTTGCTGAGGAACGAAGCT
 
. : . : . : . : . : . :
JMFS073E07+ TCGTGTTTGTTTTTCTTCAAACCCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCT
                      ____________________________________________________________
consensus TCGTGTTTGTTTTTCTTCAAACCCCCAATCCGCTCTCGCTCGCCGCTACTAACGGGGTCT
 
. : . : . : . : . : . :
JMFS073E07+ CGGTTGATTTCCCTTCCTTTAGCTACTAAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCC
                      ____________________________________________________________
consensus CGGTTGATTTCCCTTCCTTTAGCTACTAAGATGTTTCAGTTCGCTAAGTTTGAAAAGTCC
 
. : . : . : . : . : . :
JMFS073E07+ AAAGAGCGCAGACTAGCCACGGAGCTTGGATACGGTTTCCCGATCGGAGATCCATGGATC
                      ____________________________________________________________
consensus AAAGAGCGCAGACTAGCCACGGAGCTTGGATACGGTTTCCCGATCGGAGATCCATGGATC
 
. : . : . : . : . : . :
JMFS073E07+ ACAGACGGTATCTCCCCATGGCCTTTCGCCTCTGAAAGCGTCCTTCCTTCTCAATGCCCG
                      ____________________________________________________________
consensus ACAGACGGTATCTCCCCATGGCCTTTCGCCTCTGAAAGCGTCCTTCCTTCTCAATGCCCG