Previous Contig 003459:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS035H06Sequence578003459 (5)sp|Q9LJU0|CBLA_ARATH1e-21COBRA-like protein 10 precursor.>gb:BT005952_1638874 Arabidopsis thaliana At3g20
JMFS040E07Sequence636003459 (5)sp|Q9LJU0|CBLA_ARATH5e-25COBRA-like protein 10 precursor.>gb:BT005952_1638874 Arabidopsis thaliana At3g20
JMFS067D02Sequence627003459 (5)sp|Q9LJU0|CBLA_ARATH5e-25COBRA-like protein 10 precursor.>gb:BT005952_1638874 Arabidopsis thaliana At3g20
JMFS072A10Sequence622003459 (5)sp|Q9LJU0|CBLA_ARATH9e-07COBRA-like protein 10 precursor.>gb:BT005952_1638874 Arabidopsis thaliana At3g20
JMFS074H12Sequence636003459 (5)sp|Q9LJU0|CBLA_ARATH7e-32COBRA-like protein 10 precursor.>gb:BT005952_1638874 Arabidopsis thaliana At3g20

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS074H12+ TCTGCGCCTGCATCTGGGTGAAATCTCCGGCGGTGTCGATGGCCGTCTTCAAATC
JMFS067D02+ TCAAATC
JMFS040E07+ TCAAATC
                      ____________________________________________________________
consensus TCTGCGCCTGCATCTGGGTGAAATCTCCGGCGGTGTCGATGGCCGTCTTCAAATC
 
. : . : . : . : . : . :
JMFS074H12+ CGTCATGGGATCTCCGGCGAACACCGTCCCGTTCTTCCCCACCTTGATCGGGAAGTCGTC
JMFS067D02+ CGTCATGGGATCTCCGGCGAACACCGTCCCGTTCTTCCCCACCTTGATCGGGAAGTCGTC
JMFS035H06+ CTTGATCGGGAAGTCGTC
JMFS040E07+ CGTCATGGGATCTCCGGCGAACACCGTCCCGTTCTTCCCCACCTTGATCGGGAAGTCGTC
                      ____________________________________________________________
consensus CGTCATGGGATCTCCGGCGAACACCGTCCCGTTCTTCCCCACCTTGATCGGGAAGTCGTC
 
. : . : . : . : . : . :
JMFS074H12+ GCCGTCGACCACGACCGCCCCTTCCGCCGACACCAACAGCTCGCGGTATTGGAACCCTAC
JMFS067D02+ GCCGTCGACCACGACCGCCCCTTCCGCCGACACCAACAGCTCGCGGTATTGGAACCCTAC
JMFS035H06+ GCCGTCGACCACGACCGCCCCTTCCGCCGACACCAACAGCTCGCGGTATTGGAACCCTAC
JMFS040E07+ GCCGTCGACCACGACCGCCCCTTCCGCCGACACCAACAGCTCGCGGTATTGGAACCCTAC
                      ____________________________________________________________
consensus GCCGTCGACCACGACCGCCCCTTCCGCCGACACCAACAGCTCGCGGTATTGGAACCCTAC
 
. : . : . : . : . : . :
JMFS074H12+ GAACGCCTTCCAGTTTTTGAGCTCCACTTTGCCGGCGTTCAGGATGGACAGCGTGGCCTT
JMFS067D02+ GAACGCCTTCCAGTTTTTGAGCTCCACTTTGCCGGCGTTCAGGATGGACAGCGTGGCCTT
JMFS035H06+ GAACGCCTTCCAGTTTTTGAGCTCCACTTTGCCGGCGTTCAGGATGGACAGCGTGGCCTT
JMFS040E07+ GAACGCCTTCCAGTTTTTGAGCTCCACTTTGCCGGCGTTCAGGATGGACAGCGTGGCCTT
JMFS072A10+ TTCAGGATGGACAGCGTGGCC-T
                      ____________________________________________________________
consensus GAACGCCTTCCAGTTTTTGAGCTCCACTTTGCCGGCGTTCAGGATGGACAGCGTGGCCTT
 
. : . : . : . : . : . :
JMFS074H12+ GAAGGACCAGGCCTGCGCCGACGTGTTCTTCACCAGGGGATAGATCTTCTCCCGCCCCTG
JMFS067D02+ GAAGGACCAGGCCTGCGCCGACGTGTTCTTCACCAGGGGATAGATCTTCTCCCGCCCCTG
JMFS035H06+ GAAGGACCAGGCCTGCGCCGACGTGTTCTTCACCAGGGGATAGATCTTCTCCCGCCCCTG
JMFS040E07+ GAAGGACCAGGCCTGCGCCGACGTGTTCTTCACCAGGGGATAGATCTTCTCCCGCCCCTG
JMFS072A10+ GAAGGACCAGGCCTGCGCCGACGTGTTCTTCACCAGGGGATAGATCTTCTCCCGCCCCTG
                      ____________________________________________________________
consensus GAAGGACCAGGCCTGCGCCGACGTGTTCTTCACCAGGGGATAGATCTTCTCCCGCCCCTG
 
. : . : . : . : . : . :
JMFS074H12+ GAAGCTGTAGGTGAGGAATATGCCGTCGCATTTCTGCTGCTCCGGCGGCGGGGCGGCCGG
JMFS067D02+ GAAGCTGTAGGTGAGGAATATGCCGTCGCATTTCTGCTGCTCCGGCGGCGGGGCGGCCGG
JMFS035H06+ GAAGCTGTAGGTGAGGAATATGCCGTCGCATTTCTGCTGCTCCGGCGGCGGGGCGGCCGG
JMFS040E07+ GAAGCTGTAGGTGAGGAATATGCCGTCGCATTTCTGCTGCTCCGGCGGCGGGGCGGCCGG
JMFS072A10+ GAAGCTGTAGGTGAGGAATATGCCGTCGCATTTCTGCTGCTCCGGCGGCGGGGCGGCCGG
                      ____________________________________________________________
consensus GAAGCTGTAGGTGAGGAATATGCCGTCGCATTTCTGCTGCTCCGGCGGCGGGGCGGCCGG
 
. : . : . : . : . : . :
JMFS074H12+ CTTGTCACCGTCCTCGTCGTAGTCATAATCGTCGTCGACTTTGGCGGCTTTGGCGGCTTT
JMFS067D02+ CTTGTCACCGTCCTCGTCGTAGTCATAATCGTCGTCGACTTTGGCGGCTTTGGCGGCTTT
JMFS035H06+ CTTGTCACCGTCCTCGTCGTAGTCATAATCGTCGTCGACTTTGGCGGCTTTGGCGGCTTT
JMFS040E07+ CTTGTCACCGTCCTCGTCGTAGTCATAATCGTCGTCGACTTTGGCGGCTTTGGCGGCTTT
JMFS072A10+ CTTGTCACCGTCCTCGTCGTAGTCATAATCGTCGTCGACTTTGGCGGCTTTGGCGGCTTT
                      ____________________________________________________________
consensus CTTGTCACCGTCCTCGTCGTAGTCATAATCGTCGTCGACTTTGGCGGCTTTGGCGGCTTT
 
. : . : . : . : . : . :
JMFS074H12+ GGCGGCCTGGGAGGTGTAACAGAGGGCGGCGATGCAGTAAGCAAAGGCCAATATCCTCCA
JMFS067D02+ GGCGGCCTGGGAGGTGTAACAGAGGGCGGCGATGCAGTAAGCAAAGGCCAATATCCTCCA
JMFS035H06+ GGCGGCCTGGGAGGTGTAACAGAGGGCGGCGATGCAGTAAGCAAAGGCCAATATCCTCCA
JMFS040E07+ GGCGGCCTGGGAGGTGTAACAGAGGGCGGCGATGCAGTAAGCAAAGGCCAATATCCTCCA
JMFS072A10+ GGCGGCCTGGGAGGTGTAACAGAGGGCGGCGATGCAGTAAGCAAAGGCCAATATCCTCCA
                      ____________________________________________________________
consensus GGCGGCCTGGGAGGTGTAACAGAGGGCGGCGATGCAGTAAGCAAAGGCCAATATCCTCCA
 
. : . : . : . : . : . :
JMFS074H12+ TGATATTCTCATACTATACCTGGAGGTAGGTATTAGGGTTTTTTTTTGGATAGGAAATTA
JMFS067D02+ TGATATTCTCATACTATACCTGGAGGTAGGTATTAGGGTTTTTTTTTGGATAGGAAATTA
JMFS035H06+ TGATATTCTCATACTATACCTGGAGGTAGGTATTAGGGTTTTTTTTTGGATAGGAAATTA
JMFS040E07+ TGATATTCTCATACTATACCTGGAGGTAGGTATTAGGGTTTTTTTTTGGATAGGAAATTA
JMFS072A10+ TGATATTCTCATACTATACCTGGAGGTAGGTATTAGGGTTTTTTTTTGGATAGGAAATTA
                      ____________________________________________________________
consensus TGATATTCTCATACTATACCTGGAGGTAGGTATTAGGGTTTTTTTTTGGATAGGAAATTA
 
. : . : . : . : . : . :
JMFS074H12+ ATTTAAGGTTTATTTGTTTTTGTGGCTAATTAGGTTTTCGGCCGGGTACGGTGGATTTAC
JMFS067D02+ ATTTAAGGTTTATTTGTTTTTGTGGCTAATTAGGTTTTCGGCCGGGTACGGTGGATTTAC
JMFS035H06+ ATTTAAGGTTTATTTGTTTTTGTGGCTAATTAGGTTTTCGGCCGGGTACGGTGGATTTAC
JMFS040E07+ ATTTAAGGTTTATTTGTTTTTGTGGCTAATTAGGTTTTCGGCCGGGTACGGTGGATTTAC
JMFS072A10+ ATTTAAGGTTTATTTGTTTTTGTGGCTAATTAGGTTTTCGGCCGGGTACGGTGGATTTAC
                      ____________________________________________________________
consensus ATTTAAGGTTTATTTGTTTTTGTGGCTAATTAGGTTTTCGGCCGGGTACGGTGGATTTAC
 
. : . : . : . : . : . :
JMFS074H12+ ACGGCCGCAGGGGAAATGAAAAGCGGAAAAACACGACGGCG
JMFS067D02+ ACGGCCGCAGGGGAAATGAAAAGCGGAAAAACACGACGGCGGCCACTACCAGAACGAAGC
JMFS035H06+ ACGGCCGCAGGGGAAATGAAAAGCGGAAAAACACGACGGCGGCCACTACCAGAACGAAGC
JMFS040E07+ ACGGCCGCAGGGGAAATGAAAAGCGGAAAAACACGACGGCGGCCACTACCAGAACGAAGC
JMFS072A10+ ACGGCCGCAGGGGAAATGAAAAGCGGAAAAACACGACGGCGGCCACTACCAGAACGAAGC
                      ____________________________________________________________
consensus ACGGCCGCAGGGGAAATGAAAAGCGGAAAAACACGACGGCGGCCACTACCAGAACGAAGC
 
. : . : . : . : . : . :
JMFS067D02+ AGGTGAGAGGCCGCAGCGTA
JMFS035H06+ AGGTGAGAGGCCGCAGCGTA
JMFS040E07+ AGGTGAGAGGCCGCAGCGTACGTGAGAG
JMFS072A10+ AGGTGAGAGGCCGCAGCGTACGTGAGAGGGAGGGTGAGCGATTGATGGATGTATCGGAGA
                      ____________________________________________________________
consensus AGGTGAGAGGCCGCAGCGTACGTGAGAGGGAGGGTGAGCGATTGATGGATGTATCGGAGA
 
. : . : . : . : . : . :
JMFS072A10+ TGAAAAGAAAAATAATGAAGAAGAAATGATGGAGAAGAGGAAGGAGGATTTCCGACACCG
                      ____________________________________________________________
consensus TGAAAAGAAAAATAATGAAGAAGAAATGATGGAGAAGAGGAAGGAGGATTTCCGACACCG
 
. : . : . : . : . : . :
JMFS072A10+ CTAAAAATGGCGTGGCTGATAATAATGCACAAAGACCTTTTCTTCGCCATTCTCATCCGA
                      ____________________________________________________________
consensus CTAAAAATGGCGTGGCTGATAATAATGCACAAAGACCTTTTCTTCGCCATTCTCATCCGA