Previous Contig 003455:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS005F09Sequence585003455 (4)gb:BT004136_16372356e-53Arabidopsis thaliana clone RAFL15-11-P18 (R20716) putative myotubularin (At3g105
JMFS056G01Sequence567003455 (4)gb:ATAC013428_15434973e-30Arabidopsis thaliana chromosome III BAC F18K10 genomic sequence, complete sequen
JMFS071E10Sequence556003455 (4)gb:BT004136_16372356e-30Arabidopsis thaliana clone RAFL15-11-P18 (R20716) putative myotubularin (At3g105
JMFS093A12Sequence623003455 (4)gb:BT004136_16372352e-45Arabidopsis thaliana clone RAFL15-11-P18 (R20716) putative myotubularin (At3g105

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS005F09+ ATCGA
                      ____________________________________________________________
consensus ATCGA
 
. : . : . : . : . : . :
JMFS005F09+ CTTTTTGGATCCATGTTACAGACCATTAAAGGGCCAGAAACAAAAGCAAAGAGATCCCAG
                      ____________________________________________________________
consensus CTTTTTGGATCCATGTTACAGACCATTAAAGGGCCAGAAACAAAAGCAAAGAGATCCCAG
 
. : . : . : . : . : . :
JMFS005F09+ AGTCTTGTTGGCCTTGTCCACTTCAATAATGCATTGTATACTGCACGTCTCTGCTTTGTT
JMFS056G01+ CTTGTCCACTTCAATAATGCATTGTATCCTGCACGTCTCTGCTTTGTT
JMFS093A12+ AGTCTTGTTGGCCTTGTCCACTTCAATAATGCATTGTATACTGCACGTCTCTGCTTTGTT
                      ____________________________________________________________
consensus AGTCTTGTTGGCCTTGTCCACTTCAATAATGCATTGTATACTGCACGTCTCTGCTTTGTT
 
. : . : . : . : . : . :
JMFS005F09+ CGAGGCCTAAAACCAAATACAATTATTCTCATATCTTTGCCTATGACCTGAAGCAGGCGC
JMFS056G01+ CGAGGCCTATAACCAAATACAATTATTCTCATATGTTTGCATATGACCTGAAGCAGGCCC
JMFS093A12+ CGAGGCCTAAAACCAAATACAATTATTCTCATATCTTTGCCTATGACCTGAAGCAGGCGC
JMFS071E10+ ATGACCTGAAGCAGGCGC
                      ____________________________________________________________
consensus CGAGGCCTAAAACCAAATACAATTATTCTCATATCTTTGCCTATGACCTGAAGCAGGCGC
 
. : . : . : . : . : . :
JMFS005F09+ CGGGATGGATTCTTGTCTGACTGATGAGCAGCAGAGGGAAGCTTCATAACCATTTTGTTA
JMFS056G01+ CTGGATGGATTCTTGTATGACTGTCGAGCAGCAGAGGAAAGCTTCATAGCCATTATGTTA
JMFS093A12+ CGGGATGGATTCTTGTCTGACTGACGAGCAGCAGAGGGAAGCTTCATAACCATTTTGTTA
JMFS071E10+ CGGGATGGATTCTTGTCTGACTGACGAGCAGCAGAGGGAAGCTTCATAACCATTTTGTTA
                      ____________________________________________________________
consensus CGGGATGGATTCTTGTCTGACTGACGAGCAGCAGAGGGAAGCTTCATAACCATTTTGTTA
 
. : . : . : . : . : . :
JMFS005F09+ AACTTCTCAATAGTTGCCAGTGCTATAGTGCCCAGTGCAATGATGTCCCTTGATCCTTCA
JMFS056G01+ AACTTCTCAATAGTTGCCAGCGTTATAGTGCCCAGTGCAATGATGTCCCTTGATCCTTCC
JMFS093A12+ AACTTCTCAATAGTTGCCAGTGCTATAGTGCCCAGTGCAATGATGTCCCTTGATCCTTCA
JMFS071E10+ AACTTCTCAATAGTTGCCAGTGCTATAGTGCCCAGTGCAATGATGTCCCTTGATCCTTCA
                      ____________________________________________________________
consensus AACTTCTCAATAGTTGCCAGTGCTATAGTGCCCAGTGCAATGATGTCCCTTGATCCTTCA
 
. : . : . : . : . : . :
JMFS005F09+ CTCAAAAATAGAAGTCGAAAATTTGTAACAAATA-AGGTTCCAGCTTCATCGGTGTTAAC
JMFS056G01+ CTCAAATATAGTAGTCGTAAATTTGTAACCAATATAGGTTCCAGCTTCATCGGTGTTAAC
JMFS093A12+ CTCAAAAATAGAAGTCGAAAATTTGTAACAAATA-AGGTTCCAGCTTCATCGGTGTTAAC
JMFS071E10+ CTCAAAAATAGAAGTCGAAAATTTGTAACAAATA-AGGTTCCAGCTTCATCGGTGTTAAC
                      ____________________________________________________________
consensus CTCAAAAATAGAAGTCGAAAATTTGTAACAAATA-AGGTTCCAGCTTCATCGGTGTTAAC
 
. : . : . : . : . : . :
JMFS005F09+ AAGAACAATGCCATTTCCCTCTACAATGACCTGCTCAGCTGGAAGCAAGAACTTCTTAAT
JMFS056G01+ AAGAACGATGCCATTTCCCTCTTCAATGACTTGGTCAGATGGAAGCAAGAAATTGTTCAT
JMFS093A12+ AAGAACAATGCCATTTCCCTCTACAATGACCTGCTCAGCTGGAAGCAAGAACTTCTTAAT
JMFS071E10+ AAGAACAATGCCATTTCCCTCTACAATGACCTGCTCAGCTGGAAGCAAGAACTTCTTAAT
                      ____________________________________________________________
consensus AAGAACAATGCCATTTCCCTCTACAATGACCTGCTCAGCTGGAAGCAAGAACTTCTTAAT
 
. : . : . : . : . : . :
JMFS005F09+ TCCCTGCGACACCGACCTCGAAAATGGTTCAATTTTGGTCCATTCAAGGGCGTCCCAGCT
JMFS056G01+ TCCATCCGACTACGACCTTGAAAATGGTTCAATTTTGGTCCATTCAAGGGCGTCCCAGCT
JMFS093A12+ TCCCTGCGACACCGACCTCGAAAATGGTTCAATTTTGGTCCATTCAAGGGCGTCCCAGCT
JMFS071E10+ TCCCTGCGACACCGACCTCGAAAATGGTTCAATTTTGGTCCATTCAAGGGCGTCCCAGCT
                      ____________________________________________________________
consensus TCCCTGCGACACCGACCTCGAAAATGGTTCAATTTTGGTCCATTCAAGGGCGTCCCAGCT
 
. : . : . : . : . : . :
JMFS005F09+ TCCGGCGCCTTCAATCCTCTCGGACTCGGCGAATCGAGTCCCAGGGTCATGGAAC
JMFS056G01+ TCCGGCGCCTTCAATCCTGTTGGACTCGCCGAATCGAGTCCCAGGGTCATGGAACAAGAT
JMFS093A12+ TCCGGCGCCTTCAATCCTCTCGGACTCGGCGAATCGAGTCCCAGGGTCATGGAACGAGGC
JMFS071E10+ TCCGGCGCCTTCAATCCTCTCGGACTCGGCGAATCGAGTCCCAGGGTCATGGAACGAGGC
                      ____________________________________________________________
consensus TCCGGCGCCTTCAATCCTCTCGGACTCGGCGAATCGAGTCCCAGGGTCATGGAACGAGGC
 
. : . : . : . : . : . :
JMFS056G01+ GGATCGCTCCGTCTGACTCCTGTACATGGTCCGTCGGCAACACGGCGGCGTTAGGTTTTT
JMFS093A12+ GGATCGCGCCGACCGACTCCTGTACATGGTCCGGCGGCGACACGGCGGCGTTAGG-TTCT
JMFS071E10+ GGATCGCGCCGCCCGACTCCTGTACATGGTCCGGCGGCGACACGGCGGCGTTAGG-TTCT
                      ____________________________________________________________
consensus GGATCGCGCCGTCCGACTCCTGTACATGGTCCGGCGGCGACACGGCGGCGTTAGG-TTCT
 
. : . : . : . : . : . :
JMFS056G01+ GGGAGCCTCTTTTGTTCTTTACTTTCCCGAATCTGTTTC
JMFS093A12+ GGTAGCTTCTTTTGTTCTTTACTTTCGCGAATCTGTTTCCTTGATTTCACGGAAATTGAA
JMFS071E10+ GGTAGCTTCTTTTGTTCTTTACTTTCGCGAATCTGTTTCCTTGATTTCACGGAAATTGAA
                      ____________________________________________________________
consensus GGTAGCTTCTTTTGTTCTTTACTTTCGCGAATCTGTTTCCTTGATTTCACGGAAATTGAA
 
. : . : . : . : . : . :
JMFS093A12+ GAAGTACGGCTCGTAATGAGTTTCA
JMFS071E10+ GAAGTCCGGCTCGTAATGAGTTTCACCGTACCCTGTTCCCTCTTCTTTCCGGAAGAGAGA
                      ____________________________________________________________
consensus GAAGTCCGGCTCGTAATGAGTTTCACCGTACCCTGTTCCCTCTTCTTTCCGGAAGAGAGA