Previous Contig 003454:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS071E09Sequence444003454 (4)gb:AK117578_18156052e-14Arabidopsis thaliana At1g24340 mRNA for unknown protein, complete cds, clone: RA
JMSF023A15Sequence653003364 (4)gb:AK117578_18156054e-25Arabidopsis thaliana At1g24340 mRNA for unknown protein, complete cds, clone: RA652003454 (4)gb:AK117578_18156051e-40Arabidopsis thaliana At1g24340 mRNA for unknown protein, complete cds, clone: RA
JMSF031K09Sequence658003364 (4)gb:AK117578_18156057e-27Arabidopsis thaliana At1g24340 mRNA for unknown protein, complete cds, clone: RA677003454 (4)gb:AK117578_18156051e-38Arabidopsis thaliana At1g24340 mRNA for unknown protein, complete cds, clone: RA
JMSF037F12Sequence646003364 (4)gb:AK117578_18156054e-25Arabidopsis thaliana At1g24340 mRNA for unknown protein, complete cds, clone: RA632003454 (4)gb:AK117578_18156051e-45Arabidopsis thaliana At1g24340 mRNA for unknown protein, complete cds, clone: RA

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF037F12+ CTGTTGCATGAACCCGAAGCACCCNC
                      ____________________________________________________________
consensus CTGTTGCATGAACCCGAAGCACCCNC
 
. : . : . : . : . : . :
rJMSF037F12+ AGGACGAAGGAGGGACTTTGTGCCCTCAGCAGATCCGGGATCAAGGTTGCCACACATAAA
rJMSF023A15+ ACGAAGGAGGGACTTTGTGCCCTCAGCAGATCCGGGATCAAGGTTGCCACACATAAA
rJMSF031K09+ GGGACTTTGTGCCCTCAGCAGATCCGGGATCAAGGTTGCCACACATAAA
                      ____________________________________________________________
consensus AGGACGAAGGAGGGACTTTGTGCCCTCAGCAGATCCGGGATCAAGGTTGCCACACATAAA
 
. : . : . : . : . : . :
rJMSF037F12+ TGTTAGACCATTTTCAAATCCACCTAGCAAGGAAACGTTTTCTACATTGGACCTTGTATC
rJMSF023A15+ TGTTAGACCATTTTCAAATCCACCTAGCAAGGAAACGTTTTNTACATTGGACCTTGTATC
rJMSF031K09+ TGTTAGACCATTTTCAAATCCNCCTAGCAAGGAAACGTTTTCTACATTGGACCTTGTATC
                      ____________________________________________________________
consensus TGTTAGACCATTTTCAAATCCACCTAGCAAGGAAACGTTTTCTACATTGGACCTTGTATC
 
. : . : . : . : . : . :
rJMSF037F12+ AGCAGAGAAGGTCGAGTTTGTTNTCATTATAGCNCCAGTGGACTCATCCTACCATCTGGC
rJMSF023A15+ AGCAGAGAAGGTCGAGTTTGTTCTCATTATAGCNCCNGNGGACTCATCCTACCATNTGGC
rJMSF031K09+ AGCAGAGAAGGTCGAGTTTGTTNTCATTATAGCACCAGTGGACTCATCCTACCATNTGGC
                      ____________________________________________________________
consensus AGCAGAGAAGGTCGAGTTTGTTCTCATTATAGCACCAGTGGACTCATCCTACCATCTGGC
 
. : . : . : . : . : . :
rJMSF037F12+ TNTGGGGGCATTCCAGGTTGCTGAGGAATGTAAAGTTNTTTTAAAGGTATGCGTGATGTG
rJMSF023A15+ TNTGGGGGCATTCCAGGTTGCTGAGGAANGTAAAGTTNTTTTAAAGGTATGCGTGATGTG
rJMSF031K09+ TCTGGGGGCATTCCAGGTTGNTGAGGAATGTAAAGTTNTTTTAAAGGTATGCGTGATGTG
                      ____________________________________________________________
consensus TCTGGGGGCATTCCAGGTTGCTGAGGAATGTAAAGTTNTTTTAAAGGTATGCGTGATGTG
 
. : . : . : . : . : . :
rJMSF037F12+ GGCAGGAGAAACTATTGCGGGACCCAACAGAAGCAAAGCTGCATTGTTACCTTGGGAGAA
rJMSF023A15+ GGCNGGAGAAACTATTGCGGGACCCAACAGAAGCAAAGCTGCATTGTTACCTTGGGAGAA
rJMSF031K09+ GGCAGGAGAAACTATTGCGGGACCCAACAGAAGCAAAGCTGCATTGTTACCTTGGGAGAA
                      ____________________________________________________________
consensus GGCAGGAGAAACTATTGCGGGACCCAACAGAAGCAAAGCTGCATTGTTACCTTGGGAGAA
 
. : . : . : . : . : . :
rJMSF037F12+ TTTNGTAGATGTTTTGGAAGTTAAGAGAGCNCCAAATTNGTNGTCTTGGTGGGATGTNTG
rJMSF023A15+ TTTNGTAGATGTTTTGGAAGTTAAGAGAGCNCCAAATTNGTCGTCTTGGTGGGATGTNTG
rJMSF031K09+ TTTNGTAGATGTTTTGGAAGTTAAGAGAGCNCCAAATTNGTCGTCTTGGTGGGATGTNTG
JMFS071E09- GTAGATGTTTTGGAAGTTAAGAGAGCACCAAATTCGTCGTCTTGGTGGGATGTCTG
                      ____________________________________________________________
consensus TTTNGTAGATGTTTTGGAAGTTAAGAGAGCACCAAATTCGTCGTCTTGGTGGGATGTCTG
 
. : . : . : . : . : . :
rJMSF037F12+ CCAGATGACAGACAGGGGAGCCATTTTAGTGAGGCCCGACGAGCATATTGCCTGGCGCAC
rJMSF023A15+ CCAGATGACAGACNGGGGAGCCNTTTTAGTGAGGCCCGACGAGCATATTGCCTGGCGCAC
rJMSF031K09+ CCNGATGACAGACAGGGGAGCCNTTTTAGTGAGGCCCGACGAGCATATTGCCTGGCGCNC
JMFS071E09- CCAGATGACAGACAGGGGAGCCATTTTAGTGAGGCCCGACGAGCATATTGCCTGGCGCAC
                      ____________________________________________________________
consensus CCAGATGACAGACAGGGGAGCCATTTTAGTGAGGCCCGACGAGCATATTGCCTGGCGCAC
 
. : . : . : . : . : . :
rJMSF037F12+ AAAGTCNCAACTTGCTGCTGATGCCNCAACTGAGATGAGAAAAGTTTTTCGCNCCNTCCT
rJMSF023A15+ AAAGTCNCAACTTGCTGCTGATGCCNCAACTGAGATGAGAAAAGTTTTTCGCNCCNTCCT
rJMSF031K09+ AAAGTCNCAACTTGCTGCTGATGCCNCAACTGAGATGAGAAAAGTTTTTCGCNCCNTCCT
JMFS071E09- AAAGTCACAACTTGCTGCTGATGCCACAACTGAGATGAGAAAAGTTTTTCGCACCATCCT
                      ____________________________________________________________
consensus AAAGTCACAACTTGCTGCTGATGCCACAACTGAGATGAGAAAAGTTTTTCGCACCATCCT
 
. : . : . : . : . : . :
rJMSF037F12+ TGGATNTCAATGACNGATGATGATACATACTCCCTAGTCCCTCCCNTTTTTTTTTTTCTT
rJMSF023A15+ TGGATNTCAATGACNGATGATGATACATACTCCGTAGTCCCTCCCNTTTTTTTTTTTCTT
rJMSF031K09+ TGGATNTCAATGACNGATGATGATACATACTCCCTAGTCCCTCCCNTTTTTTTTTTTCTT
JMFS071E09- TGGATCTCAATGACAGATGATGATACATACTCCCTAGTCCCTCCCATTTTTTTTTTTCTT
                      ____________________________________________________________
consensus TGGATCTCAATGACAGATGATGATACATACTCCCTAGTCCCTCCCATTTTTTTTTTTCTT
 
. : . : . : . : . : . :
rJMSF037F12+ CCAAGTAAATATCATAAATAGTTTCATTTTCTTGTATTACCATTCTAATTAAAGCTGGAA
rJMSF023A15+ CCAAGTAAATATCATAAATAGTTTCATTTTCTTGTATTACCATTCTAATTAAAGCTGGAA
rJMSF031K09+ CCAAGTAAATATCATAAATAGTTTCATTTTCTTGTATTACCATTCTAATTAAAGCTGGAA
JMFS071E09- CCAAGTAAATATCATAAATAGTTTCATTTTCTTGTATTACCATTCTAATTAAAGCTGGAA
                      ____________________________________________________________
consensus CCAAGTAAATATCATAAATAGTTTCATTTTCTTGTATTACCATTCTAATTAAAGCTGGAA
 
. : . : . : . : . : . :
rJMSF037F12+ AAGTTG
rJMSF023A15+ AAGTTGTGTACTTTCTATGGGCAATCAGAAGAGGAAAAATANGTAGTTTTCCT
rJMSF031K09+ AAGTTGTGTACTTTCTATGGGCAATCAGAAGAGGAAAAATATGTAGTTTTCCTT
JMFS071E09- AAGTTGTGTACTTTCTATGGGCAATGAGAAGAGGAAAAATATGTAGTTTTCCTTXXXXXX
                      ____________________________________________________________
consensus AAGTTGTGTACTTTCTATGGGCAATCAGAAGAGGAAAAATATGTAGTTTTCCTTNNNNNN
 
. : . : . : . : . : . :
JMFS071E09- XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXTAAAGGGGGGGGGGGGACCCAAA
                      ____________________________________________________________
consensus NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAAGGGGGGGGGGGGACCCAAA