Previous Contig 003449:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF026O05Sequence598003449 (10)gb:CQ785718_14527713e-40Sequence 31 from Patent WO2004018687.>gb:ATH271472_1552219 Arabidopsis thaliana 659003449 (10)gb:CQ785718_14527713e-40Sequence 31 from Patent WO2004018687.>gb:ATH271472_1552219 Arabidopsis thaliana
JMFF033O06Sequence468003449 (10)gb:CQ785718_14527711e-32Sequence 31 from Patent WO2004018687.>gb:ATH271472_1552219 Arabidopsis thaliana 749003449 (10)gb:CQ785718_14527714e-40Sequence 31 from Patent WO2004018687.>gb:ATH271472_1552219 Arabidopsis thaliana
JMFF043I19Sequence618003449 (10)gb:CQ785718_14527711e-39Sequence 31 from Patent WO2004018687.>gb:ATH271472_1552219 Arabidopsis thaliana 603003449 (10)gb:CQ785718_14527712e-25Sequence 31 from Patent WO2004018687.>gb:ATH271472_1552219 Arabidopsis thaliana
JMFF049I04Sequence620003449 (10)gb:CQ785718_14527713e-40Sequence 31 from Patent WO2004018687.>gb:ATH271472_1552219 Arabidopsis thaliana 606003449 (10)gb:CQ785718_14527713e-40Sequence 31 from Patent WO2004018687.>gb:ATH271472_1552219 Arabidopsis thaliana
JMFS071A06Sequence536003449 (10)gb:CQ785718_14527719e-28Sequence 31 from Patent WO2004018687.>gb:ATH271472_1552219 Arabidopsis thaliana
JMSF003L10Sequence425003449 (10)gb:CQ785718_14527712e-35Sequence 31 from Patent WO2004018687.>gb:ATH271472_1552219 Arabidopsis thaliana 561004588 (33)gb:STU307031_17230414e-41Solanum tuberosum mRNA for ferredoxin I (fed1 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF043I19- TTTTTTTTTTTTTTCXXXXXXXX
                      ____________________________________________________________
consensus TTTTTTTTTTTTTTCNNNNNNNN
 
. : . : . : . : . : . :
rJMFF043I19- XXXXXXXXXXXXXXXXXXXXXXXXXXCCCATCCATAATGACCAATCACCACTGAAAGGTC
rJMFF033O06- TAATGACCAATCACCACTGAAAGGTC
                      ____________________________________________________________
consensus NNNNNNNNNNNNNNNNNNNNNNNNNNCCCATCCATAATGACCAATCACCACTGAAAGGTC
 
. : . : . : . : . : . :
rJMFF043I19- AACATTTCAATTCTTTTAACTAAAGGAACCTTCAGCACAAAACTTAACCACATCTGAGTC
rJMFF033O06- AACATTTCAATTCTTTTAACTAAAGGAACCTTCAGCACAAAACTTAACCACATCTGAGTC
                      ____________________________________________________________
consensus AACATTTCAATTCTTTTAACTAAAGGAACCTTCAGCACAAAACTTAACCACATCTGAGTC
 
. : . : . : . : . : . :
rJMFF043I19- CTGAGTACTAAAACAAAAACCCCCCACTTTACTTTTTAAAAAATTCAGGCTAGGTTTTCT
rJMFF049I04- AACAAAAACCCACCACATTACATTTTAAAGAATTCAGGCTAGGTTTTCT
rJMFF033O06- CTGAGTACTAGAACAAAAACCCACCACATTACATTTTAAAGAATTCAGGCTAGGTTTTCT
rJMFF026O05- ATTCAGGCTAGGTTTTCT
                      ____________________________________________________________
consensus CTGAGTACTAGAACAAAAACCCACCACATTACATTTTAAAGAATTCAGGCTAGGTTTTCT
 
. : . : . : . : . : . :
rJMFF043I19- AAATGTTCATTTGTTTGCCACTAAAGGAAAACATCTTACATTAGTTGAAACCAAAAACTG
rJMFF049I04- AGATGTTCATTTGTTTGCCACTAAAGGAGAACATCTTACATTAGTTGAAACCAAAAACTG
rJMFF033O06- AGATGTTCATTTGTTTGCCACTAAAGGAGAACATCTTACATTAGTTGAAACCAAAAACTG
rJMFF026O05- AGATGTTCATTTGTTTGCCACTAAAGGAGAACATCTTACATTAGTTGAAACCAAAAACTG
JMFF026O05+ GTTGAAACCAAAAACTG
JMFF049I04+ AAAGGAGAACATCTTACATTAGTTGAAACCAAAAACTG
                      ____________________________________________________________
consensus AGATGTTCATTTGTTTGCCACTAAAGGAGAACATCTTACATTAGTTGAAACCAAAAACTG
 
. : . : . : . : . : . :
rJMFF043I19- GCCCTTTTTTCTTTGTTATGGATAACTGATACTACTCTGCAGAAACAAAAGCCGAAGTAT
rJMFF049I04- GTCCTTTTTTCTTTGTTATGGATAACTGATACTACTCTGCAGTAACAAAAGCCGAAGTAT
rJMFF033O06- GTCCTTTTTTCTTTGTTATGGATAACTGATACTACTCTGCAGTAACAAAAGCCGAAGTAT
rJMFF026O05- GTCCTTTTTTCTTTGTTATGGATAACTGATACTACTCTGCAGTAACAAAAGCCGAAGTAT
JMFF026O05+ GTCCTTTTTTCTTTGTTATGGATAACTGATACTACTCTGCAGTAACAAAAGCCGAAGTAT
JMFF049I04+ GTCCTTTTTTCTTTGTTATGGATAACTGATACTACTCTGCAGTAACAAAAGCCGAAGTAT
JMFF043I19+ GTCCTTTNTTCTTTGTTATGGATAACTGATACTACTCTGCAGTAACAAAAGCCGAAGTAT
                      ____________________________________________________________
consensus GTCCTTTTTTCTTTGTTATGGATAACTGATACTACTCTGCAGTAACAAAAGCCGAAGTAT
 
. : . : . : . : . : . :
rJMFF043I19- TTATCTTGGGCTGCCATTTAATTGCATTAGGTTCAAAAATCATCCTTGCTTACATTAAAA
rJMFF049I04- TTATCTTGTGCTGCCATTTAATTGCATTAGGTTCAAAGATCATCCTTGCTTACATTAAGA
rJMFF033O06- TTATCTTGTGCTGCCATTTAATTGCATTAGGTTCAAAGATCATCCTTGCTTACATTAAGA
rJMFF026O05- TTATCTTGTGCTGCCATTTAATTGCATTAGGTTCAAAGATCATCCTTGCTTACATTAAGA
JMFF026O05+ TTATCTTGTGCTGCCATTTAATTGCATTAGGTTCAAAGATCATCCTTGCTTACATTAAGA
JMFF049I04+ TTATCTTGTGCTGCCATTTAATTGCATTAGGTTCAAAGATCATCCTTGCTTACATTAAGA
JMFF043I19+ TTATCTTGTGCTGCCATTTAATTGCATTAGGTTCAAAGATCATCCTTGCTTACATTAAGA
                      ____________________________________________________________
consensus TTATCTTGTGCTGCCATTTAATTGCATTAGGTTCAAAGATCATCCTTGCTTACATTAAGA
 
. : . : . : . : . : . :
rJMFF043I19- CCTAGGAGTTTAGCCAATTTTCCGCTTTCATAGGCCTCAATAGTATCATCAAATCCTCCG
rJMFF049I04- CCTAGGAGTTTAGCCAATTTTCCGCTTTCATAGGCCTCGATAGTATCATCAGATCCTCCG
rJMFF033O06- CCTAGGAGTTTAGCCAATTTTCCGCTTTCATAGGCCTCGATAGTATCATCAGATCCTCCG
rJMFF026O05- CCTAGGAGTTTAGCCAATTTTCCGCTTTCATAGGCCTCGATAGTATCATCAGATCCTCCG
JMSF003L10+ TTTCATAGGCCTCGATAGTATCATCAGATCCTCCG
JMFF026O05+ CCTAGGAGTTTAGCCAATTTTCCGCTTTCATAGGCCTCGATAGTATCATCAGATCCTCCG
JMFF049I04+ CCTAGGAGTTTAGCCAATTTTCCGCTTTCATAGGCCTCGATAGTATCATCAGATCCTCCG
JMFF043I19+ CCTAGGAGTTTAGCCAATTTTCCGCTTTCATAGGCCTCGATAGTATCATCAGATCCTCCG
JMFF033O06+ CCTCGATAGTATCATCAGATCCTNCG
                      ____________________________________________________________
consensus CCTAGGAGTTTAGCCAATTTTCCGCTTTCATAGGCCTCGATAGTATCATCAGATCCTCCG
 
. : . : . : . : . : . :
rJMFF043I19- ATGTGATTTCCATTAATGAAAACCTGTGGCACCGTACGCCTTCCAACCACCTCATTTACG
rJMFF049I04- ATGTGCTTTCCATTAATGAAAACCTGTGGCACCGTACGCCTTCCAACCACCTCACTTACG
rJMFF033O06- ATGTGCTTTCCATTAATGAAAACCTGTGGCACCGTACGCCTTCCAACCACCTCACTTACG
rJMFF026O05- ATGTGCTTTCCATTAATGAAAACCTGTGGCACCGTACGCCTTCCAACCACCTCACTTACG
JMSF003L10+ ATGTGCTTTCCATTAATGAAAACCTGTGGCACCGTACGCCTTCCAACCACCTCACTTACG
JMFF026O05+ ATGTGCTTTCCATTAATGAAAACCTGTGGCACCGTACGCCTTCCAACCACCTCACTTACG
JMFF049I04+ ATGTGCTTTCCATTAATGAAAACCTGTGGCACCGTACGCCTTCCAACCACCTCACTTACG
JMFF043I19+ ATGTGATTTCCATTAATGAAAACCTGTGGCACCGTACGCCTTCCAACCACCTCACTTACG
JMFF033O06+ ATGTGCTTTCCATTAATGAAAACCTGTGGCACCGTACGCCTTCCAACCACCTCACTTACG
JMFS071A06+ GCTTTCCATTAATGAAAACCTGTGGCACCGTACGCCTTCCAACCACCTCACTTACG
                      ____________________________________________________________
consensus ATGTGCTTTCCATTAATGAAAACCTGTGGCACCGTACGCCTTCCAACCACCTCACTTACG
 
. : . : . : . : . : . :
rJMFF043I19- GCATTTTGAATAAGCCATCCATCATCTCTCTCATCAAGCTCAACAACATAAGCTTTCTGC
rJMFF049I04- GCATTTTGAATAAGCCATCCATCATCTCTCTCATCAAGCTCAACAACATAAGCTTTCTGC
rJMFF033O06- GCATTTTGAATAAGCCATCCATCATCTCTCTCATCAAGCTCAACAACATAAGCTTTCTGC
rJMFF026O05- GCATTTTGAATAAGCCATCCATCATCTCTCTCATCAAGCTCAACAACATAAGCTTTCTGC
JMSF003L10+ GCATTTTGAATAAGCCATCCATCATCTCTCTCATCAAGCTCAACAACATAAGCTTTCTGC
JMFF026O05+ GCATTTTGAATAAGCCATCCATCATCTCTCTCATCAAGCTCAACAACATAAGCTTTCTGC
JMFF049I04+ GCATTTTGAATAAGCCATCCATCATCTCTCTCATCAAGCTCAACAACATAAGCTTTCTGC
JMFF043I19+ GCATTTTGAATAAGCCATCCATCATCTCTCTCATCAAGCTCAACAACATAAGCTTTCTGC
JMFF033O06+ GCATTTTGAATAAGCCATCCATCATCTCTCTCATCAAGCTCAACAACATAAGCTTTCTGC
JMFS071A06+ GCATTTTGAATAAGCCATCCATCATCTCTCTCATCAAGCTCAACAACATAAGCTTTCTGC
                      ____________________________________________________________
consensus GCATTTTGAATAAGCCATCCATCATCTCTCTCATCAAGCTCAACAACATAAGCTTTCTGC
 
. : . : . : . : . : . :
rJMFF043I19- TTCAATTCTTTAAAGACAGCCTTTGCCCTTTTA
rJMFF049I04- TTCAATTCTTTAAAGACAGCCTTTGCCCTTTTACAATATGGGCAGTAGGATTTGGAGAAA
rJMFF033O06- TTCAATTCTTTAAAGACAGCCTTTGCCCTTTTACAATATGGGCAGTAGGATTTGGAGAAA
rJMFF026O05- TTCAATTCTTTAAAGACAGCCTTTGCCCTTTTACAATATGGGCAGTAGGATTTGGAGAAA
JMSF003L10+ TTCAATTCTTTAAAGACAGCCTTTGCCCTTTTACAATATGGGCAGTAGGATTTGGAGAAA
JMFF026O05+ TTCAATTCTTTAAAGACAGCCTTTGCCCTTTTACAATATGGGCAGTAGGATTTGGAGAAA
JMFF049I04+ TTCAATTCTTTAAAGACAGCCTTTGCCCTTTTACAATATGGGCAGTAGGATTTGGAGAAA
JMFF043I19+ TTCAATTCTTTAAAGACAGCCTTTGCCCTTTTACAATATGGGCAGTAGGATTTGGAGAAA
JMFF033O06+ TTCAATTCTTTAAAGACAGCCTTTGCCCTTTTACAATATGGGCAGTAGGATTTGGAGAAA
JMFS071A06+ TTCAATTCTTTAAAGACAGCCTTTGCCCTTTTACAATATGGGCAGTAGGATTTGGAGAAA
                      ____________________________________________________________
consensus TTCAATTCTTTAAAGACAGCCTTTGCCCTTTTACAATATGGGCAGTAGGATTTGGAGAAA
 
. : . : . : . : . : . :
rJMFF049I04- ATGACAATGGAATGAGAAGAAATGGTTTTCTTCACAAAGGCGGCGGCAGCTTCCGATTGG
rJMFF033O06- ATGACAATGGAATGAGAAGAAATGGTTTTCTTCACAAAGGCGGCGGCAGCTTCCGATTGG
rJMFF026O05- ATGACAATGGAATGAGAAGAAATGGTTTTCTTCACAAAGGCGGCGGCAGCTTCCGATTGG
JMSF003L10+ ATGACAATGGAATGAGAAGAAATGGTTTTCTTCACAAAGGCGGCGGCAGCTTCCGATTGG
JMFF026O05+ ATGACAATGGAATGAGAAGAAATGGTTTTCTTCACAAAGGCGGCGGCAGCTTCCGATTGG
JMFF049I04+ ATGACAATGGAATGAGAAGAAATGGTTTTCTTCACAAAGGCGGCGGCAGCTTCCGATTGG
JMFF043I19+ ATGACAATGGAATGAGAAGAAATGGTTTTCTTCACAAAGGCGGCGGCAGCTTCCGATTGG
JMFF033O06+ ATGACAATGGAATGAGAAGAAATGGTTTTCTTCACAAAGGCGGCGGCAGCTTCCGATTGG
JMFS071A06+ ATGACAATGGAATGAGAAGAAATGGTTTTCTTCACAAAGGCGGCGGCAGCTTCCGATTGG
                      ____________________________________________________________
consensus ATGACAATGGAATGAGAAGAAATGGTTTTCTTCACAAAGGCGGCGGCAGCTTCCGATTGG
 
. : . : . : . : . : . :
rJMFF049I04- GCATCGTCTTCGTCGGAATCGTCGATGGATGCAGATGTGGTCCCCGCAAACACAAGGGCA
rJMFF033O06- GCATCGTCTTCGTCGGAATCGTCGATGGATGCAGATGTGGTCCCCGCAAACACAAGGGCA
rJMFF026O05- GCATCGTCTTCGTCGGAATCGTCGATGGATGCAGATGTGGTCCCCGCAAACACAAGGGCA
JMSF003L10+ GCATCGTCTTCGTCGGAATCGTCGATGGATGCAGATGTGGTCCCCGCAAACACAAGGGCA
JMFF026O05+ GCATCGTCTTCGTCGGAATCGTCGATGGATGCAGATGTGGTCCCCGCAAACACAAGGGCA
JMFF049I04+ GCATCGTCTTCGTCGGAATCGTCGATGGATGCAGATGTGGTCCCCGCAAACACAAGGGCA
JMFF043I19+ GCATCGTCTTCGTCGGAATCGTCGATGGATGCAGATGTGGTCCCCGCAAACACAAGGGCA
JMFF033O06+ GCATCGTCTTCGTCGGAATCGTCGATGGATGCAGATGTGGTCCCCGCAAACACAAGGGCA
JMFS071A06+ GCATCGTCTTCGTCGGAATCGTCGATGGATGCAGATGTGGTCCCCGCAAACACAAGGGCA
                      ____________________________________________________________
consensus GCATCGTCTTCGTCGGAATCGTCGATGGATGCAGATGTGGTCCCCGCAAACACAAGGGCA
 
. : . : . : . : . : . :
rJMFF049I04- AACAGGATTGTGACC
rJMFF033O06- AACAGGATTGTGACCCCAAACACTACCAAGAGAGATGATTTCGCCATTTGATATAGGGNT
rJMFF026O05- AACAGGATTGTGACCCCAAACACTACCAAGAGAGATGATTTCGCCATTTGATATAGGGTT
JMSF003L10+ AACAGGATTGTGACCCCAAACACTACCAAGAGAGATGATTTCGCCATTTGATATAGGGTT
JMFF026O05+ AACAGGATTGTGACCCCAAACACTACCAAGAGAGATGATTTCGCCATTTGATATAGGGTT
JMFF049I04+ AACAGGATTGTGACCCCAAACACTACCAAGAGAGATGATTTCGCCATTTGATATAGGGTT
JMFF043I19+ AACAGGATTGTGACCCCAAACACTACCAAGAGAGATGATTTCGCCATTTGATATAGGGTT
JMFF033O06+ AACAGGATTGTGACCCCAAACACTACCAAGAGAGATGATTTCGCCATTTGATATAGGGTT
JMFS071A06+ AACAGGATTGTGACCCCAAACCCTACCAAGAGAGATGATTTCGCCATTTGATATAGGGTT
                      ____________________________________________________________
consensus AACAGGATTGTGACCCCAAACACTACCAAGAGAGATGATTTCGCCATTTGATATAGGGTT
 
. : . : . : . : . : . :
rJMFF033O06- GAG
rJMFF026O05- GAGAAAGATCGATGTAAAGAAATTCGGGCAAGGAGAC
JMSF003L10+ GAGAAAGATCGATGTAAAGAAATTCG
JMFF026O05+ GAGAAAGATCGATGTAAAGAAATTCGGGCAAGGAGAC
JMFF049I04+ GAGAAAGATCGATGTAAAGAAATTCGGGCAAGGAGAC
JMFF043I19+ GAGAAAGATCGATGTAAAGAAATTCGGGCAAGGAGACTTCTGCAGACTTAAAAACTCTGG
JMFF033O06+ GAGAAAGATCGATGTAAAGAAATTCGGGCAAGGAGACTTCTGCAGACTTAAAAACTCTGG
JMFS071A06+ GAGAAAGATCGATGTAAAGAAATTCGGGCAAGGAGACTTCTGCAGACTTAAAAACTCTGG
                      ____________________________________________________________
consensus GAGAAAGATCGATGTAAAGAAATTCGGGCAAGGAGACTTCTGCAGACTTAAAAACTCTGG
 
. : . : . : . : . : . :
JMFF043I19+ ATGGGTGTGTT
JMFF033O06+ ATGGGTGTGTT
JMFS071A06+ ATGGGTGTGTTCTCGAGTTTTTTTTTTTTTTTTTTGGCTGCTAATAGTTGAGTGTGGCAG
                      ____________________________________________________________
consensus ATGGGTGTGTTCTCGAGTTTTTTTTTTTTTTTTTTGGCTGCTAATAGTTGAGTGTGGCAG
 
. : . : . : . : . : . :
JMFS071A06+ AACTAATAGCTTAATTTTGAGTGCATTTTGGTAGGGAATGAAATTTTGTATTCACTGCTG
                      ____________________________________________________________
consensus AACTAATAGCTTAATTTTGAGTGCATTTTGGTAGGGAATGAAATTTTGTATTCACTGCTG