Previous Contig 003447:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS068D05Sequence637003447 (3)
JMFS070H06Sequence618003447 (3)
JMFS144D09Sequence624003447 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS144D09+ GTCATCCACTTGTTNTGTTTTCAAATTCTTGGAACTA
                      ____________________________________________________________
consensus GTCATCCACTTGTTNTGTTTTCAAATTCTTGGAACTA
 
. : . : . : . : . : . :
JMFS144D09+ TCATGTAAACAAGAAGAAAGACTCGCTTTTCCACTAGTTCCAGGTCGGTAACATAGCAAT
                      ____________________________________________________________
consensus TCATGTAAACAAGAAGAAAGACTCGCTTTTCCACTAGTTCCAGGTCGGTAACATAGCAAT
 
. : . : . : . : . : . :
JMFS144D09+ GGATTACGGCCTTCATGGTAGTTCAATGAGCACGAAATACTTCTCCCACCTAGTAACCTA
JMFS068D05+ GGCCTTCATGGTAGTTCAATGAGCACGAAATACTTCTCCCACCTAGTAACCTA
JMFS070H06+ CTCCCACCTAGTAACCTA
                      ____________________________________________________________
consensus GGATTACGGCCTTCATGGTAGTTCAATGAGCACGAAATACTTCTCCCACCTAGTAACCTA
 
. : . : . : . : . : . :
JMFS144D09+ AAAATACCAAAATCCGACATTCTGGTAATATTAGCACTACTATCTCCATCCGACTGCATA
JMFS068D05+ AAAATACCAAAATCCGACATTCTGGTAATATTAGCACTACTATCTCCATCCGACTGCATA
JMFS070H06+ AAAATACCAAAATCCGACATTCTGGTAATATTAGCACTACTATCTCCATCCGACTGCATA
                      ____________________________________________________________
consensus AAAATACCAAAATCCGACATTCTGGTAATATTAGCACTACTATCTCCATCCGACTGCATA
 
. : . : . : . : . : . :
JMFS144D09+ GGTGCTTTGTTTGATTTAACCAACGACAATCCATCCACAGTCAATTCAGAACCTTCTTTT
JMFS068D05+ GGTGCTTTGTCTGATTTAACCAACGACAATCCATCCACAGTCAATTCAGAACCTTCTTTT
JMFS070H06+ GGTGCTTTGTCTGATTTAACCAACGACAATCCATCCACAGTCAATTCAGAACCTTCTTTT
                      ____________________________________________________________
consensus GGTGCTTTGTCTGATTTAACCAACGACAATCCATCCACAGTCAATTCAGAACCTTCTTTT
 
. : . : . : . : . : . :
JMFS144D09+ TTAGGTAAAAACTCAGGCAATGTTGAAGGGAAGCAAAACAAGTTTGCATTTGGGCATGCA
JMFS068D05+ TTAGGTAAAAACTCAGGCAATGTTGAAGGGAAGCAAAACAAGTTTGCATTTGGGCATGCA
JMFS070H06+ TTAGGTAAAAACTCAGGCAATGTTGAAGGGAAGCAAAACAAGTTTGCATTTGGGCATGCA
                      ____________________________________________________________
consensus TTAGGTAAAAACTCAGGCAATGTTGAAGGGAAGCAAAACAAGTTTGCATTTGGGCATGCA
 
. : . : . : . : . : . :
JMFS144D09+ ATGTCAAGACTTAACTGAGGTGCAGAAACTTGTGTCAATTCTGAGCCTATATCTCCACCC
JMFS068D05+ ATGTCAAGACTTAACTGAGGTGCAGAAACTTGTGTCAATTCTGAGCCTATATCTCCACCC
JMFS070H06+ ATGTCAAGACTTAACTGAGGTGCAGAAACTTGTGTCAATTCTGAGCCTATATCTCCACCC
                      ____________________________________________________________
consensus ATGTCAAGACTTAACTGAGGTGCAGAAACTTGTGTCAATTCTGAGCCTATATCTCCACCC
 
. : . : . : . : . : . :
JMFS144D09+ AAAACACCAGGAAAATTTGTATCCACCCCTCTGTAGGATCTATAAGCATCACAGTTAACC
JMFS068D05+ AAAACACCAGGAAAATTTGTATCCACCCCTCTGTAGGATCTATAAGCATCACAGTTAACC
JMFS070H06+ AAAACACCAGGAAAATTTGTATCCACCCCTCTGTAGGATCTATAAGCATCACAGTTAACC
                      ____________________________________________________________
consensus AAAACACCAGGAAAATTTGTATCCACCCCTCTGTAGGATCTATAAGCATCACAGTTAACC
 
. : . : . : . : . : . :
JMFS144D09+ TCATTTCCAGTTTCTTGACAAGGTTCACATTTAGCCACAGTAAGAAGGGCAGATAACAGA
JMFS068D05+ TCATTTCCAGTTTCTTGACAAGGTTCACATTTAGCCACAGTAAGAAGGGCAGATAACAGA
JMFS070H06+ TCATTTCCAGTTTCTTGACAAGGTTCACATTTAGCCACAGTAAGAAGGGCAGATAACAGA
                      ____________________________________________________________
consensus TCATTTCCAGTTTCTTGACAAGGTTCACATTTAGCCACAGTAAGAAGGGCAGATAACAGA
 
. : . : . : . : . : . :
JMFS144D09+ ATGACAAGGTGAAACACAGCCCAAGAAGAACGCTGCGGCTGAGGTTTGATCATTTTCAGG
JMFS068D05+ ATGACAAGGTGAAACACAGCCCAAGAAGAACGCTGCGGCTGAGGTTTGATCATTTTCAGG
JMFS070H06+ ATGACAAGGTGAAACACAGCCCAAGAAGAACGCTGCGGCTGAGGTTTGATCATTTTCAGG
                      ____________________________________________________________
consensus ATGACAAGGTGAAACACAGCCCAAGAAGAACGCTGCGGCTGAGGTTTGATCATTTTCAGG
 
. : . : . : . : . : . :
JMFS144D09+ AAGAGGAAGAATAAGAAGAAGAAGAACTCCATGGCTGAGAAAGCGAA
JMFS068D05+ AAGAGGAAGAATAAGAAGAAGAAGAACTCCATGGCTGAGAAAGCGAAGAAACCATCCGCA
JMFS070H06+ AAGAGGAAGAATAAGAAGAAGAAGAACTCCATGGCTGAGAAAGCGAAGAAACCATCCGCA
                      ____________________________________________________________
consensus AAGAGGAAGAATAAGAAGAAGAAGAACTCCATGGCTGAGAAAGCGAAGAAACCATCCGCA
 
. : . : . : . : . : . :
JMFS068D05+ AATCTAGAAGATTCCTTTCCTTGTTGTGTTTCAGTTTTAGGGATTTTTGTTGGAATCGAT
JMFS070H06+ AATCTAGAAGATTCCTTTCCTTGTTGTGTTTCAGTTTTAGGGATTTTTGTTGGAATCGAT
                      ____________________________________________________________
consensus AATCTAGAAGATTCCTTTCCTTGTTGTGTTTCAGTTTTAGGGATTTTTGTTGGAATCGAT
 
. : . : . : . : . : . :
JMFS068D05+ TTCGTCCAGGAAAATGCTTGGAGCAAAAGCACACCTGATAACAG
JMFS070H06+ TTCGTCCAGGAAAATGCTTGGAGCAAAAGCACACCTGATAACAGCGATGAATGAATGAAT
                      ____________________________________________________________
consensus TTCGTCCAGGAAAATGCTTGGAGCAAAAGCACACCTGATAACAGCGATGAATGAATGAAT