Previous Contig 003436:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011H12Sequence490003436 (4)gb:AP004992_18468681e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN748008713 (4)gb:BT000948_16352032e-20Arabidopsis thaliana clone C105055 unknown protein (At3g15095) mRNA, complete cd
JMFS069D05Sequence623003436 (4)gb:BT000948_16352031e-10Arabidopsis thaliana clone C105055 unknown protein (At3g15095) mRNA, complete cd
JMSF001J16Sequence339003436 (4)677008713 (4)gb:BT000948_16352031e-22Arabidopsis thaliana clone C105055 unknown protein (At3g15095) mRNA, complete cd
JMSF011G14Sequence425003436 (4)gb:AP004992_18468681e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN780008713 (4)gb:BT000948_16352032e-20Arabidopsis thaliana clone C105055 unknown protein (At3g15095) mRNA, complete cd

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF011G14+ GCCTTCTTGTTGCTGATAATGGACGCT
JMFS069D05+ TTCTTGTTGCTGATAATGGACGCT
                      ____________________________________________________________
consensus GCCTTCTTGTTGCTGATAATGGACGCT
 
. : . : . : . : . : . :
JMSF011G14+ CGAACTCCTCTGGTTTTGGAGACACAGCCTATCCCTTTCCTCGCCCAGATTCATCCCTTC
JMFS069D05+ CGAACTCCTCTGGTTTTGGAGACACAGCCTATCCCTTTCCTCGCTCAGATTCATCCCGTC
                      ____________________________________________________________
consensus CGAACTCCTCTGGTTTTGGAGACACAGCCTATCCCTTTCCTCGCTCAGATTCATCCCTTC
 
. : . : . : . : . : . :
JMSF011G14+ CTGGGCCTGTTCTAATTTCCTGAAACTCAAATCCCCACTTCTTCTCTTCGACAAGCTTCT
JMFF011H12+ TCTAATTTCCTGAAACTCAAATCCCCACTTCTTCTCTTCGACAAGCTTCT
JMFS069D05+ CTGCGCTTGTTCTACTTTCCTGAAACTCAAATCCCCACTTCTTCGCGTCGACAAGCTTCT
                      ____________________________________________________________
consensus CTGGGCTTGTTCTAATTTCCTGAAACTCAAATCCCCACTTCTTCTCTTCGACAAGCTTCT
 
. : . : . : . : . : . :
JMSF011G14+ GCTGTGCTTCACCTTCTTCTTACTCTTCACCCGGACTTGCCCAATGCAAGTAACCTTAGG
JMFF011H12+ GCTGTGCTTCACCTTCTTCTTACTCTTCACCCGGACTTGCCCAATGCAAGTAACCTTAGG
JMFS069D05+ GCTGTGCTTCACCTTCTTCTTAGTCTTCACCCGGACTTGCCCAATGCAAGTAACCTTGGG
                      ____________________________________________________________
consensus GCTGTGCTTCACCTTCTTCTTACTCTTCACCCGGACTTGCCCAATGCAAGTAACCTTAGG
 
. : . : . : . : . : . :
JMSF011G14+ GGAAGACGGCTCCGGATTCTCGAAACCCGACCCGCGCTTCTTGGCGGAACTGGGGAACAT
JMFF011H12+ GGAAGACGGCTCCGGATTCTCGAAACCCGACCCGCGCTTCTTGGCGGAACTGGGGAACAT
JMSF001J16+ CTGGGGAACAT
JMFS069D05+ GGAAGACGGCTCCGGATTCTCGAAAGCAGAGCCGCGCTTCTTGGCGGAACTGGGGAACAT
                      ____________________________________________________________
consensus GGAAGACGGCTCCGGATTCTCGAAACCCGACCCGCGCTTCTTGGCGGAACTGGGGAACAT
 
. : . : . : . : . : . :
JMSF011G14+ GGGGGAAGCCTGACCCGCCTTGATGCTGCCATTGGAGCGCAGCCTCCGGCTAAGGGAAGT
JMFF011H12+ GGGGGAAGCCTGACCCGCCTTGATGCTGCCATTGGAGCGCAGCCTCCGGCTAAGGGAAGT
JMSF001J16+ GGGGGAAGCCTGACCCGCCTTGATGCTGCCATTGGAGCGCAGCNTCCGGCTAAGGGAAGT
JMFS069D05+ GGGGGAAGCCTGACCGGCCTTGATGCTGCCATTGGAGCGGAGCCTCCGGCTAAGGGAAGT
                      ____________________________________________________________
consensus GGGGGAAGCCTGACCCGCCTTGATGCTGCCATTGGAGCGCAGCCTCCGGCTAAGGGAAGT
 
. : . : . : . : . : . :
JMSF011G14+ TGAGAGAGAAACAGAAGGGTCTCGAGCCCGACCCGGACTGAGTATAGATTTGGAAAGCTT
JMFF011H12+ TGAGAGAGAAACAGAAGGGTCTCGAGCCCGACCCGGACTGAGTATAGATTTGGAAAGCTT
JMSF001J16+ TGAGAGAGAAACAGAAGGGTCTCGAGCCCGACCCGGACTGAGTATAGATTTGGAAAGCTT
JMFS069D05+ TGAGAGAGAAACGGAGGGGTCTCGAGCCCGACCCGGACTGAGTATAGATTTGGAAAGCTT
                      ____________________________________________________________
consensus TGAGAGAGAAACAGAAGGGTCTCGAGCCCGACCCGGACTGAGTATAGATTTGGAAAGCTT
 
. : . : . : . : . : . :
JMSF011G14+ CATGGAAGAGGAAGAAGAAAGACGAGAAGTGAAA
JMFF011H12+ CATGGAAGAGGAAGAAGAAAGACGAGAAGTGAAACAAACAAAGAGCTCACCAGTAGGGGT
JMSF001J16+ CATGGAAGAGGAAGAAGAAAGACGAGAAGTGAAACAAACAAAGAGCTCACCAGTAGGGGT
JMFS069D05+ CATTGAAGAGGAAGAAGAAAGACGAGATGTGAAACAAACAAAGAGCTCACCAGTAGGGGT
                      ____________________________________________________________
consensus CATGGAAGAGGAAGAAGAAAGACGAGAAGTGAAACAAACAAAGAGCTCACCAGTAGGGGT
 
. : . : . : . : . : . :
JMFF011H12+ ACTAGTAGTAGTAGTACTTGTGCTTGGAGTTCTGTGAT---GCGGTCTATCCAAGTCCAT
JMSF001J16+ ACTAGTAGTAGTAGTACTTGTGCTTGGAGTTCTGTGAT---GCGGTCTATCCAAGTCCAT
JMFS069D05+ A---GTAGTAGTAGTACTTGCGCTTGGAGTTCTGTGATGGGGGGGTCTATCCAAGTCCAT
                      ____________________________________________________________
consensus ACTAGTAGTAGTAGTACTTGTGCTTGGAGTTCTGTGAT---GCGGTCTATCCAAGTCCAT
 
. : . : . : . : . : . :
JMFF011H12+ ACTGTAAAAATTTCACCT
JMSF001J16+ ACTGTAAAAATTTCACCT
JMFS069D05+ ACCGTCAAAATTTTACCTTGTTGTTTTGCCCATGAACTGTTTGATAGTGGGTCTGAGTAC
                      ____________________________________________________________
consensus ACTGTAAAAATTTCACCTTGTTGTTTTGCCCATGAACTGTTTGATAGTGGGTCTGAGTAC
 
. : . : . : . : . : . :
JMFS069D05+ TGAAAGACTGCACAAATGGTGAACGATAATTGAAGCGAGGAGAGGAGAATTGGTTCTGTA
                      ____________________________________________________________
consensus TGAAAGACTGCACAAATGGTGAACGATAATTGAAGCGAGGAGAGGAGAATTGGTTCTGTA