Previous Contig 003432:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS068H03Sequence561003432 (2)gb:AY899999_16320565e-94Vitis vinifera clone BACCA01_001393 sucrose-phosphate synthase 1 mRNA, complete
JMFS074E03Sequence625003432 (2)gb:AY899999_16320561e-85Vitis vinifera clone BACCA01_001393 sucrose-phosphate synthase 1 mRNA, complete

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS074E03+ GTTTTATCAGTTCCAATTAAGGCCTTGAGGTCTGCATCGCATTCGACTAGATCTTGTGC
                      ____________________________________________________________
consensus GTTTTATCAGTTCCAATTAAGGCCTTGAGGTCTGCATCGCATTCGACTAGATCTTGTGC
 
. : . : . : . : . : . :
JMFS074E03+ TTTAACACTGCTGAAGTCCATCCCCGGTGGTATAACCACCATCCTAGGCATGTATCGTCC
                      ____________________________________________________________
consensus TTTAACACTGCTGAAGTCCATCCCCGGTGGTATAACCACCATCCTAGGCATGTATCGTCC
 
. : . : . : . : . : . :
JMFS074E03+ GAGGCAACTAACTCCCCGTTGTCTCCTAACTCGAAGCTTCCTCTCCAATTGTACATCGAA
                      ____________________________________________________________
consensus GAGGCAACTAACTCCCCGTTGTCTCCTAACTCGAAGCTTCCTCTCCAATTGTACATCGAA
 
. : . : . : . : . : . :
JMFS074E03+ ACCATCATACAAACCCCATTGCTCTTCAATCTCTTGGCGTGTGCTAGTGACCACCATTTC
                      ____________________________________________________________
consensus ACCATCATACAAACCCCATTGCTCTTCAATCTCTTGGCGTGTGCTAGTGACCACCATTTC
 
. : . : . : . : . : . :
JMFS074E03+ TGCAGCATCGAGTGCCAACTCTTCAGCTTCAATCCTTCTCAGTATTTTGTACGTGGCGTT
                      ____________________________________________________________
consensus TGCAGCATCGAGTGCCAACTCTTCAGCTTCAATCCTTCTCAGTATTTTGTACGTGGCGTT
 
. : . : . : . : . : . :
JMFS074E03+ TATATCCTCCTTGGTGAGCCTCCCCTGTTTAAGTAGTTGCTCAAACTTGTTTCTACCTAG
JMFS068H03+ CTCAAACTTGTTTCTACCTAG
                      ____________________________________________________________
consensus TATATCCTCCTTGGTGAGCCTCCCCTGTTTAAGTAGTTGCTCAAACTTGTTTCTACCTAG
 
. : . : . : . : . : . :
JMFS074E03+ CGAGTGGCCTGTTAAAACCATTGGCACGTTTAAGGTCCCGGATAGCCGTGCTGCTATCTC
JMFS068H03+ CGAGTGGCCTGTTAACACCATTGGCACGTTTAAGGTCCCGGATAGCCGTGCTGCTATCTC
                      ____________________________________________________________
consensus CGAGTGGCCTGTTAACACCATTGGCACGTTTAAGGTCCCGGATAGCCGTGCTGCTATCTC
 
. : . : . : . : . : . :
JMFS074E03+ TGCTGCATCCGCATAATGGCCATGGATCACATAAGGCCACACCGGTTTCCCATCGTTCAC
JMFS068H03+ TGCTGCATCCGCATAATGGCCATGGATCACATAAGGCCACACCGGTTTCCCATCGTTCAC
                      ____________________________________________________________
consensus TGCTGCATCCGCATAATGGCCATGGATCACATAAGGCCACACCGGTTTCCCATCGTTCAC
 
. : . : . : . : . : . :
JMFS074E03+ ATGTTCTCCTAAAGCTCTTGCCATATTCACAATGTGGCCTAAAGCCCCGTCTATGAATTC
JMFS068H03+ ATGTTCTCCTAAAGCTCTTGCCATATTCACAATGTGGCCTAAAGCCCCGTCTATGAATTC
                      ____________________________________________________________
consensus ATGTTCTCCTAAAGCTCTTGCCATATTCACAATGTGGCCTAAAGCCCCGTCTATGAATTC
 
. : . : . : . : . : . :
JMFS074E03+ TGGTATATATGGCCACAGCGATTCTTTTGGAATGTAT
JMFS068H03+ TGGTATATATGGCCACAGCGATTCTTTTGGAATGTATTTATCCCGTGGTCCACAGGGGAT
                      ____________________________________________________________
consensus TGGTATATATGGCCACAGCGATTCTTTTGGAATGTATTTATCCCGTGGTCCACAGGGGAT
 
. : . : . : . : . : . :
JMFS068H03+ TCGGACTATATAGGCACCACAGCTTCCAAAACCGTCAGATGGGCATGATAGCATCTCGAT
                      ____________________________________________________________
consensus TCGGACTATATAGGCACCACAGCTTCCAAAACCGTCAGATGGGCATGATAGCATCTCGAT
 
. : . : . : . : . : . :
JMFS068H03+ TGGTTCACCATAGCTGAAGTCTACCTCTGGAGAAGTGATTTGTCGGGTGAGAAGATCAAC
                      ____________________________________________________________
consensus TGGTTCACCATAGCTGAAGTCTACCTCTGGAGAAGTGATTTGTCGGGTGAGAAGATCAAC
 
. : . : . : . : . : . :
JMFS068H03+ ACGATGGACTCCGTTCATGTTGGAAAGTGCTCGTGCTAGCTCTACAACATACTTCACCTG
                      ____________________________________________________________
consensus ACGATGGACTCCGTTCATGTTGGAAAGTGCTCGTGCTAGCTCTACAACATACTTCACCTG
 
. : . : . : . : . : . :
JMFS068H03+ ACCACCAGTATCAGAATCCCGTCCAAGTTCCATGTTTTCTCCACGAACCAACCCGTGAAT
                      ____________________________________________________________
consensus ACCACCAGTATCAGAATCCCGTCCAAGTTCCATGTTTTCTCCACGAACCAACCCGTGAAT
 
. : . : . : . : . : . :
JMFS068H03+ ACTGATGAGGACAATGTAGAGTTGTCTTGGCTTATCGTCATCACACCATATCTGTGTATC
                      ____________________________________________________________
consensus ACTGATGAGGACAATGTAGAGTTGTCTTGGCTTATCGTCATCACACCATATCTGTGTATC