Previous Contig 003428:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015D06Sequence542003428 (4)770020991gb:AK175797_18177855e-18Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL22-
JMFS045F04Sequence588003428 (4)
JMFS050G08Sequence496003428 (4)
JMFS068B12Sequence626003428 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS045F04+ GATACCTAGCTCGG
                      ____________________________________________________________
consensus GATACCTAGCTCGG
 
. : . : . : . : . : . :
JMFF015D06+ CTGGGACTTCTGCTCCTGCCTTCTCCCCTTCCCCTGCTCCTGCTCCTG
JMFS045F04+ TCCCTTCTCCTACTGGGACTTNTGCTCCTGCCTTCTCCCCTTCCCTTGCTCCTGCTCCTG
                      ____________________________________________________________
consensus TCCCTTCTCCTACTGGGACTTCTGCTCCTGCCTTCTCCCCTTCCCTTGCTCCTGCTCCTG
 
. : . : . : . : . : . :
JMFF015D06+ TCTCTTGCAGGGTGCCTGCGGGATTGGCTTGATCGGTGATCAGGGGACCGGCAACCCCTT
JMFS045F04+ TCTCTTGCAGGGTGCCTGCGGGATTGGCTTGATCGGTGATCAGGGGACCGGCAACCCCTT
JMFS050G08+ GCGGGATTGGCTTGATCGGTGATCAGGGGACCGGCTACCCCTT
JMFS068B12+ CGGTGATCAGGGGACCGGCAACCCC-T
                      ____________________________________________________________
consensus TCTCTTGCAGGGTGCCTGCGGGATTGGCTTGATCGGTGATCAGGGGACCGGCAACCCCTT
 
. : . : . : . : . : . :
JMFF015D06+ TGCTTCCCCCGTCCATCAAAACTTGGAGACATGCTTCTATATAAGTCTTTTTTCCCATCA
JMFS045F04+ TGCTTCCCCCGTCCATCAAAACTTGGAGACATGCTTCTATATAAGTCTTTTTTCCCATCA
JMFS050G08+ TGCTTCCCCCGTCCTTCAAAACTTGGAGACATGCTTTTATATAAGTCTTTTTTCCCATCA
JMFS068B12+ TGCTTCCNCCGTCCATCAAAACTTGGAGACATGCTTCTATATAAGTCTTTTTTCCCATCA
                      ____________________________________________________________
consensus TGCTTCCCCCGTCCATCAAAACTTGGAGACATGCTTCTATATAAGTCTTTTTTCCCATCA
 
. : . : . : . : . : . :
JMFF015D06+ GCTTCTTCAGTTTCTGGAACTCGTTCCCCATGTTGGCTGCTCCTATGACTCTCCTGGGGA
JMFS045F04+ GCTTCTTCAGTTTCTGGAACTCGTTCCCCATGTTGGCTGCTCCTATGACTCTCCTGGGGA
JMFS050G08+ GCTTCTTCAGTTTCTGGAACTCGTTCCCCATGTTGGCTGCTCCTATGACTCTCCTGGGGA
JMFS068B12+ GCTTCTTCAGTTTCTGGAACTCGTTCCCCATGTTGGCTGCTCCTATGACTCTCCTGGGGA
                      ____________________________________________________________
consensus GCTTCTTCAGTTTCTGGAACTCGTTCCCCATGTTGGCTGCTCCTATGACTCTCCTGGGGA
 
. : . : . : . : . : . :
JMFF015D06+ ACATTTTGTGGTGATAAGAAATCAGTTTTTGAAGCACTGTTTTCCTGATAACTAGGGTAC
JMFS045F04+ ACATTTTGTGGTGATAAGAAATCAGTTTTTGAAGCACTGTTTTCCTGATAACTAGGGTAC
JMFS050G08+ TCATTTTGTGGTGATAAGAAATCAGTTTTTGAAGCACTGTTTTCCTGATAATTAGGGTAC
JMFS068B12+ ACATTTTGTGGTGATAAGAAATCAGTTTTTGAAGCACTGTTTTCCTGATAACTAGGGTAC
                      ____________________________________________________________
consensus ACATTTTGTGGTGATAAGAAATCAGTTTTTGAAGCACTGTTTTCCTGATAACTAGGGTAC
 
. : . : . : . : . : . :
JMFF015D06+ TGTCCCTTTCCAGACCATGCATTTTTATCATTTGGCTCAACATGAAGAGAAGTATCTTCT
JMFS045F04+ TGTCCCTTTCCAGACCATGCATTTTTATCATTTGGCTCAACATGAAGAGAAGTATCTTCT
JMFS050G08+ TGTCCCTTTCCAGACCATGCATTTTTATCATTTGGCTCAACATGAAGAGAAGTATCTTCT
JMFS068B12+ TGTCCCTTTCCAGACCATGCATTTTTATCATTTGGCTCAACATGAAGAGAAGTATCTTCT
                      ____________________________________________________________
consensus TGTCCCTTTCCAGACCATGCATTTTTATCATTTGGCTCAACATGAAGAGAAGTATCTTCT
 
. : . : . : . : . : . :
JMFF015D06+ TCTGCATCCCACAAACTTTTGCGCTTTCTTACAGTCTCACCCATTGGACCGCTTTATTGA
JMFS045F04+ TNTGCATCCCACAAACTTTTGCGCTTTCTTACAGTCTCACCCATTGGACCGCTTTATTGA
JMFS050G08+ TCTGCATCCCACAAACTTTTGCGCTTTCTTACAGTCTCACCCATTGGACCGCTTTATTGA
JMFS068B12+ TCTGCATCCCACAAACTTTTGCGCTTTCTTACAGTCTCACCCATTGGACCGCTTTATTGA
                      ____________________________________________________________
consensus TCTGCATCCCACAAACTTTTGCGCTTTCTTACAGTCTCACCCATTGGACCGCTTTATTGA
 
. : . : . : . : . : . :
JMFF015D06+ TTAATGTCAACAATATTATCTTCCCGTGTGCAGTATGAT
JMFS045F04+ TTAATGTCAACAATATTATCTTCCCGTGTGCAGTATGAT
JMFS050G08+ TTAATGTCAACAATATTATCTTCCCGTGTGCAGTATGAT
JMFS068B12+ TTAATGTCAACAATATTATCTTCCCGTGTGCAGTATGATATTACGCAGCTTCACACAGTG
                      ____________________________________________________________
consensus TTAATGTCAACAATATTATCTTCCCGTGTGCAGTATGATATTACGCAGCTTCACACAGTG
 
. : . : . : . : . : . :
JMFS068B12+ GGCACAAAGTTGTTCAAACAGCTAACGTTGAAGACACAAAATCACACTTCGGATTCACAC
                      ____________________________________________________________
consensus GGCACAAAGTTGTTCAAACAGCTAACGTTGAAGACACAAAATCACACTTCGGATTCACAC
 
. : . : . : . : . : . :
JMFS068B12+ TTTATTTCCTTGGGTCTTGATCAAGATCCGCAGCTGCAGGCTGCAGCTATGCGAGAGAAG
                      ____________________________________________________________
consensus TTTATTTCCTTGGGTCTTGATCAAGATCCGCAGCTGCAGGCTGCAGCTATGCGAGAGAAG
 
. : . : . : . : . : . :
JMFS068B12+ GATGGCTATAGAGAGGCAGAGAGATAACGGCAAAATAGATCAGGGACGAGGATGTGGGTT
                      ____________________________________________________________
consensus GATGGCTATAGAGAGGCAGAGAGATAACGGCAAAATAGATCAGGGACGAGGATGTGGGTT
 
. : . : . : . : . : . :
JMFS068B12+ TGTTTCTTCTTCGTCTTCGTTTTCCTCGTGTTTCTTTCTATATTTTGCTTTAAGGTTTTC
                      ____________________________________________________________
consensus TGTTTCTTCTTCGTCTTCGTTTTCCTCGTGTTTCTTTCTATATTTTGCTTTAAGGTTTTC