Previous Contig 003426:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS029H09Sequence627003426 (2)gb:AB011270_15113162e-43Oryza sativa (japonica cultivar-group) mRNA for importin-beta1, complete cds.>gb
JMFS068B03Sequence627003426 (2)gb:AB011270_15113164e-43Oryza sativa (japonica cultivar-group) mRNA for importin-beta1, complete cds.>gb

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS029H09+ GTCATATTAGCAAGTAATGATCCAACAAGT
JMFS068B03+ ATATTAGCAAGTAATGATCCAACAAGT
                      ____________________________________________________________
consensus GTCATATTAGCAAGTAATGATCCAACAAGT
 
. : . : . : . : . : . :
JMFS029H09+ TCTGGCCACTCTTTTCGTGGGATTNCAATTGAAGCTATCTTGGCAATCACTTGGGAAGAA
JMFS068B03+ TCTGGCCACTCTNTTCGTGGGATTTCAATTGAAGCTATCTTGGCAATCACTTGGGAAGAA
                      ____________________________________________________________
consensus TCTGGCCACTCTTTTCGTGGGATTTCAATTGAAGCTATCTTGGCAATCACTTGGGAAGAA
 
. : . : . : . : . : . :
JMFS029H09+ GTATGACTGGCATCGCGTACAGAAGAGTTGAGGGTGTTTAGAAGCAAGTTTTTAATTTGG
JMFS068B03+ GTATGACTGGCATCGCGTACAGAAGAGTTGAGGGTGTTTAGAAGCAAGTTTTTAATTTGG
                      ____________________________________________________________
consensus GTATGACTGGCATCGCGTACAGAAGAGTTGAGGGTGTTTAGAAGCAAGTTTTTAATTTGG
 
. : . : . : . : . : . :
JMFS029H09+ GACTTAAGTGAAACATCAATTGCTGTCCATTGTTGAACAAGGTGTTCTTTCGTGGAAGCT
JMFS068B03+ GACTTAAGTGAAACATCAATTGCTGTCCATTGTTGAACAAGGTGTTCTTTCGTGGAAGCT
                      ____________________________________________________________
consensus GACTTAAGTGAAACATCAATTGCTGTCCATTGTTGAACAAGGTGTTCTTTCGTGGAAGCT
 
. : . : . : . : . : . :
JMFS029H09+ TCTTTTGCGTCCAAAGAGTTCTTAAGCACAATACCAGCCAGTCTACGAGATTCAACAGGT
JMFS068B03+ TCTTTTGCGTCCAAAGAGTTCTTAAGCACAATACCAGCCAGTCTACGAGATTCAACAGGT
                      ____________________________________________________________
consensus TCTTTTGCGTCCAAAGAGTTCTTAAGCACAATACCAGCCAGTCTACGAGATTCAACAGGT
 
. : . : . : . : . : . :
JMFS029H09+ TTTCCATCATTGGAGAGTTCAACTGCCAATGACAGAAGAAAAACTGGCAGATTCTGCTCT
JMFS068B03+ TTTCCATCATTGGAGAGTTCAACTGCCAATGACAGAAGAAAAACTGGCAGATTCTGCTCT
                      ____________________________________________________________
consensus TTTCCATCATTGGAGAGTTCAACTGCCAATGACAGAAGAAAAACTGGCAGATTCTGCTCT
 
. : . : . : . : . : . :
JMFS029H09+ TTGAACTGAGTTAGAGTTGCCTCTGCTTCAGTCCGTATCTTTGCATCTGCCGATTGAGCA
JMFS068B03+ TTGAACTGAGTTAGAGTTGCCTCTGCTTCAGTCCGTATCTTTGCATCTGCCGATTGAGCA
                      ____________________________________________________________
consensus TTGAACTGAGTTAGAGTTGCCTCTGCTTCAGTCCGTATCTTTGCATCTGCCGATTGAGCA
 
. : . : . : . : . : . :
JMFS029H09+ GATAGTAGAAAGTTGGTGATCTCCAAAGCCATTTCTTCTCTTAGATGCGAAACCTCCAAG
JMFS068B03+ GATAGTAGAAAGTTGGTGATCTCCAAAGCCATTTCTTCTCTTAGATGCGAAACCTCCAAG
                      ____________________________________________________________
consensus GATAGTAGAAAGTTGGTGATCTCCAAAGCCATTTCTTCTCTTAGATGCGAAACCTCCAAG
 
. : . : . : . : . : . :
JMFS029H09+ TACGAAACACTACGAAATCGACCGACGACGACGCCGCTCGCTAACTAGGGCTTTCTCCTC
JMFS068B03+ TACGAAACACTACGAAATCGACCGACGACGACGCCGCTCGCTAACTAGGGCTTTCTCCTC
                      ____________________________________________________________
consensus TACGAAACACTACGAAATCGACCGACGACGACGCCGCTCGCTAACTAGGGCTTTCTCCTC
 
. : . : . : . : . : . :
JMFS029H09+ GACTTCTCCCTCAATCGAACAGTGACGTGCTTATATATATAAGCGGCGGTTGCTTGTATG
JMFS068B03+ GACTTCTCCCTCAATCGAACAGTGACGTGCTTATATATATAAGCGGCGGTTGCTTGTATG
                      ____________________________________________________________
consensus GACTTCTCCCTCAATCGAACAGTGACGTGCTTATATATATAAGCGGCGGTTGCTTGTATG
 
. : . : . : . : . : . :
JMFS029H09+ TATCGGCGACGGTGAAGGAATGAGAAATTGATGGAGTAGAGAGAGAGAGAAACGGGA
JMFS068B03+ TATCGGCGACGGTGAAGGAATGAGAAATTGATGGAGTAGAGAGAGAGAGAAACGGGAGTA
                      ____________________________________________________________
consensus TATCGGCGACGGTGAAGGAATGAGAAATTGATGGAGTAGAGAGAGAGAGAAACGGGAGTA