Previous Contig 003425:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS068A12Sequence211003425 (9)
JMSF014D22Sequence142003425 (9)gb:AY059911_15647551e-07Arabidopsis thaliana Unknown protein (AT5g24810;F6A4.20) mRNA, complete cds.>gb:
JMSF017L13Sequence228003255 (11)756003425 (9)gb:AY059911_15647556e-31Arabidopsis thaliana Unknown protein (AT5g24810;F6A4.20) mRNA, complete cds.>gb:
JMSF020B14Sequence678003255 (11)gb:AY059911_15647556e-64Arabidopsis thaliana Unknown protein (AT5g24810;F6A4.20) mRNA, complete cds.>gb:759003425 (9)gb:AY059911_15647552e-31Arabidopsis thaliana Unknown protein (AT5g24810;F6A4.20) mRNA, complete cds.>gb:
JMSF027D16Sequence647003255 (11)gb:AY059911_15647558e-81Arabidopsis thaliana Unknown protein (AT5g24810;F6A4.20) mRNA, complete cds.>gb:804003425 (9)gb:AY059911_15647551e-36Arabidopsis thaliana Unknown protein (AT5g24810;F6A4.20) mRNA, complete cds.>gb:
JMSF028K16Sequence680003255 (11)gb:AY059911_15647551e-64Arabidopsis thaliana Unknown protein (AT5g24810;F6A4.20) mRNA, complete cds.>gb:746003425 (9)gb:AY059911_15647555e-30Arabidopsis thaliana Unknown protein (AT5g24810;F6A4.20) mRNA, complete cds.>gb:
JMSF040P17Sequence651003255 (11)gb:AY059911_15647559e-83Arabidopsis thaliana Unknown protein (AT5g24810;F6A4.20) mRNA, complete cds.>gb:783003425 (9)gb:AY059911_15647552e-34Arabidopsis thaliana Unknown protein (AT5g24810;F6A4.20) mRNA, complete cds.>gb:
JMSF048K14Sequence654003255 (11)gb:AY059911_15647559e-62Arabidopsis thaliana Unknown protein (AT5g24810;F6A4.20) mRNA, complete cds.>gb:738003425 (9)gb:AY059911_15647552e-29Arabidopsis thaliana Unknown protein (AT5g24810;F6A4.20) mRNA, complete cds.>gb:
JMSF052H02Sequence671020609803003425 (9)gb:AY059911_15647554e-34Arabidopsis thaliana Unknown protein (AT5g24810;F6A4.20) mRNA, complete cds.>gb:

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF052H02+ TGCAGTTACCCTTNCCTATCATGTTTAATGCACTCNC
rJMSF027D16+ TCTGCAGNTACCCTT-CCTATCATGTTTAATGCACTCAC
rJMSF040P17+ TTTAATGCACTCAC
                      ____________________________________________________________
consensus TCTGCAGTTACCCTTNCCTATCATGTTTAATGCACTCAC
 
. : . : . : . : . : . :
rJMSF052H02+ TACTCGCCGTGCCATTATACCTGCTGCCAATGGACATTGCTCAGCTCGTGCACTTGCTCG
rJMSF027D16+ TACTCGCCGTGCCATTATACCTGCTGCCAATGGACATTGCTCAGCTCGTGCACTTGCTCG
rJMSF040P17+ TACTCGCCGTGCCATTATACCTGCTGCCAATGGACATTGCTCAGCTCGTGCACTTGCTCG
rJMSF020B14+ GCCATTATACCTGCTGCCAATGGACATTGCTCAGCTCGTGCACTTGCTCG
rJMSF028K16+ ACCTGCTGCCAATGGACATTGCTCAGCTCGTGCACTTGCTCG
rJMSF048K14+ CCAATGGACATTGCTCAGCTCGTGCACTTGCTCG
rJMSF017L13+ ATTATACCTGCTGCCAATGGACATTGCTCAGCTCGTGCACTTGCTCG
                      ____________________________________________________________
consensus TACTCGCCGTGCCATTATACCTGCTGCCAATGGACATTGCTCAGCTCGTGCACTTGCTCG
 
. : . : . : . : . : . :
rJMSF052H02+ CTACTATGCAGCGCTTGTTGATGGTGGTAAAATTCCCCCACTGTCGTCTTCTTCCATGCC
rJMSF027D16+ CTACTATGCAGCGCTTGTTGATGGTGGTAAAATTCCCCCACTGTCGTCTTCTTCCATGCC
rJMSF040P17+ CTACTATGCAGCGCTTGTTGATGGTGGTAAAATTCCCCCACTGTCGTCTTCTTCCATGCC
rJMSF020B14+ CTACTATGCAGCGCTTGTTGATGGTGGTAAAATTCCCCCACTGTCGTCTTCTTCCATGCC
rJMSF028K16+ CTACTATGCAGCGCTTGTTGATGGTGGTAAAATTCCCCCACTGTCGTCTTCTTCCATGCC
rJMSF048K14+ CTACTATGCAGCGCTTGTTGATGGTGGTAAAATTCCCCCACTGTCGTCTTCTTCCATGCC
rJMSF017L13+ CTACTATGCAGCGCTTGTTGATGGTGGTAAAATTCCCCCACTGTCGTCTTCTTCCATGCC
                      ____________________________________________________________
consensus CTACTATGCAGCGCTTGTTGATGGTGGTAAAATTCCCCCACTGTCGTCTTCTTCCATGCC
 
. : . : . : . : . : . :
rJMSF052H02+ ACCACTGGGAAGCCACCGACACGTTCCTAAATTCCCTTCTCCGAAGACCCCCAAAAAAAA
rJMSF027D16+ ACCACTGGGAAGCCACCGACACGTTCCTAAATTCCCTTCTCCGAAGACCCCCAAAAAAAA
rJMSF040P17+ ACCACTGGGAAGCCACCGACACGTTCCTAAATTCCCTTCTCCGAAGACCCCCAAAAAAAA
rJMSF020B14+ ACCACTGGGAAGCCACCGACACGTTCCTAAATTCCCTTCTCCGAAGACCCCCAAAAAAAA
rJMSF028K16+ ACCACTGGGAAGCCACCGACACGTTCCTAAATTCCCTTCTCCGAAGACCCCCAAAAAAAA
rJMSF048K14+ ACCACTGGGAAGCCACCGACACGTTCCTAAATTCCCTTCTCCGAAGACCCCCAAAAAAAA
rJMSF017L13+ ACCACTGGGAAGCCACCGACACGTTCCTAAATTCCCTTCTCCGAAGACCCCCAAAAAAAA
                      ____________________________________________________________
consensus ACCACTGGGAAGCCACCGACACGTTCCTAAATTCCCTTCTCCGAAGACCCCCAAAAAAAA
 
. : . : . : . : . : . :
rJMSF052H02+ GCTATTAGCTAGATGGAGGAAGGCTGATTCAGAAAGCGGTGATAGCTCTGATAGCGANGA
rJMSF027D16+ GCTATTAGCTAGATGGAGGAAGGCTGATTCAGAAAGCGGTGATAGCTCTGATAGCGATGA
rJMSF040P17+ GCTATTAGCTAGATGGAGGAAGGCTGATTCAGAAAGCGGTGATAGCTCTGATAGCGATGA
rJMSF020B14+ GCTATTAGCTAGATGGAGGAAGGCTGATTCAGAAAGCGGTGATAGCTCTGATAGCGATGA
rJMSF028K16+ GCTATTAGCTAGATGGAGGAAGGCTGATTCAGAAAGCGGTGATAGCTCTGATAGCGATGA
rJMSF048K14+ GCTATTAGCTAGATGGAGGAAGGCTGATTCAGAAAGCGGTGATAGCTCTGATAGCGATGA
rJMSF017L13+ GCTATTAGCTAGATGGAGGAAGGCTGATTCAGAAAGCGGTGATAGCTCTGATAGCGATGA
                      ____________________________________________________________
consensus GCTATTAGCTAGATGGAGGAAGGCTGATTCAGAAAGCGGTGATAGCTCTGATAGCGATGA
 
. : . : . : . : . : . :
rJMSF052H02+ TGGTTCTAGCAGAAATGCTAGTGGTAACGAGTACGTATTGGTTGTCAATGATGACGNCAC
rJMSF027D16+ TGGTTCTAGCAGAAATGCTAGTGGTAACGAGTACGTATTGGTTGTCAATGATGACGACAC
rJMSF040P17+ TGGTTCTAGCAGAAATGCTAGTGGTAACGAGTACGTATTGGTTGTCAATGATGACGACAC
rJMSF020B14+ TGGTTCTAGCAGAAATGCTAGTGGTAACGAGTACGTATTGGTTGTCAATGATGACGACAC
rJMSF028K16+ TGGTTCTAGCAGAAATGCTAGTGGTAACGAGTACGTATTGGTTGTCAATGATGACGACAC
rJMSF048K14+ TGGTTCTAGCAGAAATGCTAGTGGTAACGAGTACGTATTGGTTGTCAATGATGACGACAC
rJMSF017L13+ TGGTTCTAGCAGAAATGCTAGTGGTAACGAGTACGTATTGGTTGTCAATGATGACGACAC
                      ____________________________________________________________
consensus TGGTTCTAGCAGAAATGCTAGTGGTAACGAGTACGTATTGGTTGTCAATGATGACGACAC
 
. : . : . : . : . : . :
rJMSF052H02+ TCCAACTGACAGCCACAATGCCAAACTTTTCAAAAACCCAAAAATCCACGAAGCATTTTT
rJMSF027D16+ TCCAACTGACAGCCACAATGCCAAACTTTTCAAAAACCCAAAAATCCACGAAGCATTTTT
rJMSF040P17+ TCCAACTGACAGCCACAATGCCAAACTTTTCAAAAACCCAAAAATCCACGAAGCATTTTT
rJMSF020B14+ TCCAACTGACAGCCACAATGCCAAACTTTTCAAAAACCCAAAAATCCACGAAGCATTTTT
rJMSF028K16+ TCCAACTGACAGCCACAATGCCAAACTTTTCAAAAACCCAAAAATCCACGAAGCATTTTT
rJMSF048K14+ TCCAACTGACAGCCACAATGCCAAACTTTTCAAAAACCCAAAAATCCACGAAGCATTTTT
rJMSF017L13+ TCCAACTGACAGCCACAATGCCAAACTTTTCAAAAACCCAAAAATCCACGAAGCATTTTT
                      ____________________________________________________________
consensus TCCAACTGACAGCCACAATGCCAAACTTTTCAAAAACCCAAAAATCCACGAAGCATTTTT
 
. : . : . : . : . : . :
rJMSF052H02+ GGGCGTTGGAGAATATGAGAAGCTGACCTATCCGGATGGGCAGTTTGGGCTCGGTTTCAA
rJMSF027D16+ GGGCGTTGGAGAATATGAGAAGCTGACCTATCCGGATGGGCAGTTTGGGCTCGGTTTCAA
rJMSF040P17+ GGGCGTTGGAGAATATGAGAAGCTGACCTATCCGGATGGGCAGTTTGGGCTCGGTTTCAA
rJMSF020B14+ GGGCGTTGGAGAATATGAGAAGCTGACCTATCCGGATGGGCAGTTTGGGCTCGGTTTCAA
rJMSF028K16+ GGGCGTTGGAGAATATGAGAAGCTGACCTATCCGGATGGGCAGTTTGGGCTCGGTTTCAA
rJMSF048K14+ GGGCGTTGGAGAATATGAGAAGCTGACCTATCCGGATGGGCAGTTTGGGCTCGGTTTCAA
rJMSF017L13+ GGGCGTTGGAGAATATGAGAAGCTGACCTATCCGGATGGGCAGTTTGGGCTCGGTTTCAA
                      ____________________________________________________________
consensus GGGCGTTGGAGAATATGAGAAGCTGACCTATCCGGATGGGCAGTTTGGGCTCGGTTTCAA
 
. : . : . : . : . : . :
rJMSF052H02+ AAGGATACACTCAAAGGACTCCGGCCTNATAGGGTTNGGTCATTCCGGCATGGGTGGATC
rJMSF027D16+ AAGGATACACTCAAAGGACTCCGGCCTTATAGGGTTTGGTCATTCCGGCATGGGTGGATC
rJMSF040P17+ AAGGATACACTCAAAGGACTCCGGCCTTATAGGGTTTGGTCATTCCGGCATGGGTGGATC
rJMSF020B14+ AAGGATACACTCAAAGGACTCCGGCCTTATAGGGTTTGGTCATTCCGGCATGGGTGGATC
rJMSF028K16+ AAGGATACACTCAAAGGACTCCGGCCTTATAGGGTTTGGTCATTCCGGCATGGGTGGATC
rJMSF048K14+ AAGGATACACTCAAAGGACTCCGGCCTTATAGGGTTTGGTCATTCCGGCATGGGTGGATC
rJMSF017L13+ AAGGATACACTCAAAGGACTCCGGCCTTATAGGGTTTGGTCATTCCGGCATGGGTGGATC
                      ____________________________________________________________
consensus AAGGATACACTCAAAGGACTCCGGCCTTATAGGGTTTGGTCATTCCGGCATGGGTGGATC
 
. : . : . : . : . : . :
rJMSF052H02+ CACAGGCTTTTGCGACATGAAGAATAGGTTTGCTATTGCAATAACACTAAACAAGTTGTC
rJMSF027D16+ CACAGGCTTTTGCGACATGAAGAATAGGTTTGCTATTGCAATAACACTAAACAAGTTGTC
rJMSF040P17+ CACAGGCTTTTGCGACATGAAGAATAGGTTTGCTATTGCAATAACACTAAACAAGTTGTC
rJMSF020B14+ CACAGGCTTTTGCGACATGAAGAATAGGTTTGCTATTGCAATAACACTAAACAAGTTGTC
rJMSF028K16+ CACAGGCTTTTGCGACATGAAGAATAGGTTTGCTATTGCAATAACACTAAACAAGTTGTC
rJMSF048K14+ CACAGGCTTTTGCGACATGAAGAATAGGTTTGCTATTGCAATAACACTAAACAAGTTGTC
rJMSF014D22+ CATGAAGAATAGGTTNGCTATTGCAATAACACTNAACAAGTNGTC
rJMSF017L13+ CACAGGCTTTTGCGACATGAAGAATAGGTTTGCTATTGCAATAACACTAAACAAGTTGTC
                      ____________________________________________________________
consensus CACAGGCTTTTGCGACATGAAGAATAGGTTTGCTATTGCAATAACACTAAACAAGTTGTC
 
. : . : . : . : . : . :
rJMSF052H02+ GTTTGGGGGCGTGACTGCAAAAATAATTCAGCTGGTTTGCTCGGAACTTAATATACCAGT
rJMSF027D16+ GTTTGGGGGCGTGACTGCAAAAATAATTCAGCTGGTTTGCTCGGAACTTAATATACCAGT
rJMSF040P17+ GTTTGGGGGCGTGACTGCAAAAATAATTCAGCTGGTTTGCTCGGAACTTAATATACCAGT
rJMSF020B14+ GTTTGGGGGCGTGACTGCAAAAATAATTCAGCTGGTTTGCTCGGAACTTAATATACCAGT
rJMSF028K16+ GTTTGGGGGCGTGACTGCAAAAATAATTCAGCTGGTTTGCTCGGAACTTAATATACCAGT
rJMSF048K14+ GTTTGGGGGCGTGACTGCAAAAATAATTCAGCTGGTTTGCTCGGAACTTAATATACCAGT
rJMSF014D22+ GTTCGGGGGCGTGACTGCAAAAATAATTCAGCTGGTTTGCTCGGACCNTAATATACCAGT
rJMSF017L13+ GTTTGGGGGCGTGACTGCAAAAATAATTCAGCTGGTTTGCTCGGAACTTAATATACCAGT
                      ____________________________________________________________
consensus GTTTGGGGGCGTGACTGCAAAAATAATTCAGCTGGTTTGCTCGGAACTTAATATACCAGT
 
. : . : . : . : . : . :
rJMSF052H02+ GCCTGAGGAGATTTCCATGAAATTGGAGAGTGAATCTAGTAATTTAGCTCAGCCCATTAT
rJMSF027D16+ GCCTGAGGAGATTTCCATGAAATTGGAGAGTGAATCTAGTAATTTAGCTCAGCCCATTAT
rJMSF040P17+ GCCTGAGGAGATTTCCATGAAATTGGAGAGTGAATCTAGTAATTTAGCTCAGCCCATTAT
rJMSF020B14+ GCCTGAGGAGATTTCCATGAAATTGGAGAGTGAATCTAGTAATTTAGCTCAGCCCATTAT
rJMSF028K16+ GCCTGAGGAGATTTCCATGAAATTGGAGAGTGAATCTAGTAATTTAGCTCAGCCCATTAT
rJMSF048K14+ GCCTGAGGAGATTTCCATGAAATTGGAGAGTGAATCTAGTAATTTAGCTCAGCCCATTAT
rJMSF014D22+ GCCTGAGGAGATTTCCANNAAATTGGAGAGTGAATCT
rJMSF017L13+ GCCTGAGGAGATTTCCATGAAATTGGAGAGTGAATCTAGTAATTTAGCTCAGCCCATTAT
JMFS068A12+ GAGTGAATCTAGTAATTTAGCTCAGCCCATTAT
                      ____________________________________________________________
consensus GCCTGAGGAGATTTCCATGAAATTGGAGAGTGAATCTAGTAATTTAGCTCAGCCCATTAT
 
. : . : . : . : . : . :
rJMSF052H02+ AANCTGATATAAGCTCCCATCTCATTTTTGTTATTGTCAGATAGTAACATTATTATTACC
rJMSF027D16+ AAACTGATATAAGCTCCCATCTCATTTTTGTTATTGTCAGATAGTAACATTATTATTA-C
rJMSF040P17+ AAACTGATATAAGCTCCCATCTCATTTTTGTTATTGTCAGATAGTAACATTATTATTA-C
rJMSF020B14+ AAACTGATATAAGCTCCCATCTCATTTTTGTTATTGTCAGATAGTAACATTATTATTA-C
rJMSF028K16+ AAACTGATATAAGCTCCCATCTCATTTTTGTTATTGTCAGATAGTAACATTATTATTA-C
rJMSF048K14+ AAACTGATATAAGCTCCCATCTCATTTTTGTTATTGTCAGATAGTAACATTATTATTA-C
rJMSF017L13+ AAACTGATATAAGCTCCCATCTCATTTTTGTTATTGTCAGATAGTAACATTATTATTA-C
JMFS068A12+ AAACTGATATAAGCTCCCATCTCATTTTTGTTATTGTCAGATAGTAACATTATTATTA-C
                      ____________________________________________________________
consensus AAACTGATATAAGCTCCCATCTCATTTTTGTTATTGTCAGATAGTAACATTATTATTA-C
 
. : . : . : . : . : . :
rJMSF052H02+ TTAGTTGTAGTAATATAGGTAAATCTCAAGTAACTGACAACGATTT
rJMSF027D16+ TTAGTTGTAGTA--ATAGGTAAATCTCAAGT-ACTGACAACGATTT
rJMSF040P17+ TTAGTTGTAGTAATATAGGTAAATCTCAAGT-ACTGACAACGATTT
rJMSF020B14+ TTAGTTGTAGTAATATAGGTAAATCTCAAGT-ACTGACAACGATTT
rJMSF028K16+ TTAGTTATAGTAATATAGGTAAATCTCAAGT-ACTGACAACGATTT
rJMSF048K14+ TTAGTTGTAGTAATATAGGTAAATCTCAAGT-ACTGACAACGATTT
rJMSF017L13+ TTAGTTGTAGTAATATAGGTAAATCTCAAGT-ACTGACAACGATTT
JMFS068A12+ TTAGTTGTAGTAATATAGGTAAATCTCCAGT-ACTGACAACGATTTTGAGGTGTAAAATG
                      ____________________________________________________________
consensus TTAGTTGTAGTAATATAGGTAAATCTCAAGT-ACTGACAACGATTTTGAGGTGTAAAATG
 
. : . : . : . : . : . :
JMFS068A12+ GTATTTACATATGAAGGCTCTTATATTCCGCAAAAAAAAAAAAAAAAAAACTCGAGACTA
                      ____________________________________________________________
consensus GTATTTACATATGAAGGCTCTTATATTCCGCAAAAAAAAAAAAAAAAAAACTCGAGACTA