Previous Contig 003423:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS046H09Sequence633003423 (2)pir|T48012|T480124e-62hypothetical protein T17J13.160 - Arabidopsis thaliana>gb:ATT17J13_1554731 Arabi
JMFS068A02Sequence627003423 (2)pir|T48012|T480121e-60hypothetical protein T17J13.160 - Arabidopsis thaliana>gb:ATT17J13_1554731 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS046H09+ GATTCACT
                      ____________________________________________________________
consensus GATTCACT
 
. : . : . : . : . : . :
JMFS046H09+ GCATAGAGACTTTCATGGAACGGATCCGCAGATTGGTTGGAAATGCTGATGGGCATAGCT
                      ____________________________________________________________
consensus GCATAGAGACTTTCATGGAACGGATCCGCAGATTGGTTGGAAATGCTGATGGGCATAGCT
 
. : . : . : . : . : . :
JMFS046H09+ AATGTCTCACAATTCGAAACATTTCCAATGCTGTTAGTGACAAACTGCTTCGATTCGATG
                      ____________________________________________________________
consensus AATGTCTCACAATTCGAAACATTTCCAATGCTGTTAGTGACAAACTGCTTCGATTCGATG
 
. : . : . : . : . : . :
JMFS046H09+ TTAGTAAGAGGTGGACCTCCTGATGAAAGACTTGTCCAGAGCCATACATTCTTTGCTGCA
JMFS068A02+ TGAAAGACTTGTCCAGAGCCATACATTCTTTGCTGCA
                      ____________________________________________________________
consensus TTAGTAAGAGGTGGACCTCCTGATGAAAGACTTGTCCAGAGCCATACATTCTTTGCTGCA
 
. : . : . : . : . : . :
JMFS046H09+ GCAACAAGTGCTGCTGATGCTTTTTGAGGTTGTGCTAGAAGAATATTATATCTACGCATT
JMFS068A02+ GCAACAAGTGCTGCTGATGCTTTTTGAGGTTGTGCTAGAAGAATATTATATCTACGCATT
                      ____________________________________________________________
consensus GCAACAAGTGCTGCTGATGCTTTTTGAGGTTGTGCTAGAAGAATATTATATCTACGCATT
 
. : . : . : . : . : . :
JMFS046H09+ CGCAACTGATGGAGAGCATTTGAAAAATCTCGATCACCAGATATCAACAAATAATTAGCA
JMFS068A02+ CGCAACTGATGGAGAGCATTTGAAAAATCTCGATCACCAGATATCAACAAATAATTAGCA
                      ____________________________________________________________
consensus CGCAACTGATGGAGAGCATTTGAAAAATCTCGATCACCAGATATCAACAAATAATTAGCA
 
. : . : . : . : . : . :
JMFS046H09+ GGAGCAGGATTGTCCACTGCCCAAAATAGCATGTCCACCAGAATCTTCTTATCACTGGCA
JMFS068A02+ GGAGCAGGATTGTCCACTGCCCAAAATAGCATGTCCACCAGAATCTTCTTATCACTGGCA
                      ____________________________________________________________
consensus GGAGCAGGATTGTCCACTGCCCAAAATAGCATGTCCACCAGAATCTTCTTATCACTGGCA
 
. : . : . : . : . : . :
JMFS046H09+ TCTTTAACACCTGCTGGGACGTGGTTGAGGGCGATGCCAGTGCTATTAAGGGCCTGCTGA
JMFS068A02+ TCTTTAACACCTGCTGGGACGTGGTTGAGGGCGATGCCAGTGCTATTAAGGGCCTGCTGA
                      ____________________________________________________________
consensus TCTTTAACACCTGCTGGGACGTGGTTGAGGGCGATGCCAGTGCTATTAAGGGCCTGCTGA
 
. : . : . : . : . : . :
JMFS046H09+ ATTGAAGGAGAGATCTTGGTGGTGTCGCCATAGGCGGAGATGGAGACAGGCCCACAGTAG
JMFS068A02+ ATTGAAGGAGAGATCTTGGTGGTGTCGCCATAGGCGGAGATGGAGACAGGCCCACAGTAG
                      ____________________________________________________________
consensus ATTGAAGGAGAGATCTTGGTGGTGTCGCCATAGGCGGAGATGGAGACAGGCCCACAGTAG
 
. : . : . : . : . : . :
JMFS046H09+ TTCATCGCCACCAGCGCGGAGCTTATGTTCTGTGCAATAGCGTGCGGGTCGGAGCCCCTG
JMFS068A02+ TTCATCGCCACCAGCGCGGAGCTTATGTTCTGTGCAATAGCGTGCGGGTCGGAGCCCCTG
                      ____________________________________________________________
consensus TTCATCGCCACCAGCGCGGAGCTTATGTTCTGTGCAATAGCGTGCGGGTCGGAGCCCCTG
 
. : . : . : . : . : . :
JMFS046H09+ GGCACCTGGCAGTTCTCTATGTCCCACCACACCGAAATCCTC
JMFS068A02+ GGCACCTGGCAGTTCTCTATGTCCCACCACACCGAAATCCTCTCAGCTGCGTACAGCGGC
                      ____________________________________________________________
consensus GGCACCTGGCAGTTCTCTATGTCCCACCACACCGAAATCCTCTCAGCTGCGTACAGCGGC
 
. : . : . : . : . : . :
JMFS068A02+ TCGGCCACGCCCTTGGGCGGCGATCCTACGCCGCCGGAGACGCTCATCTAATCTAATCGA
                      ____________________________________________________________
consensus TCGGCCACGCCCTTGGGCGGCGATCCTACGCCGCCGGAGACGCTCATCTAATCTAATCGA
 
. : . : . : . : . : . :
JMFS068A02+ GTGTCGGCGAAGAATTAGAAAGAGTAGACTAGTGAGTATGAAGGTATAGTGAGTTACTGA
                      ____________________________________________________________
consensus GTGTCGGCGAAGAATTAGAAAGAGTAGACTAGTGAGTATGAAGGTATAGTGAGTTACTGA