Previous Contig 003421:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS067G12Sequence617003421 (3)gb:AE005173_8927712e-39Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC023673_153
JMFS075C05Sequence620003421 (3)gb:AE005173_8927712e-39Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC023673_153
JMFS168D05Sequence623003421 (3)gb:AE005173_8927714e-39Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC023673_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS067G12+ CATTGGAGACAATGAAG
                      ____________________________________________________________
consensus CATTGGAGACAATGAAG
 
. : . : . : . : . : . :
JMFS067G12+ AAAAATTATGCTTAAGACCATGGCTTTCAGCTAAATTAGTAGTAGAAAAGGAACTATCAA
                      ____________________________________________________________
consensus AAAAATTATGCTTAAGACCATGGCTTTCAGCTAAATTAGTAGTAGAAAAGGAACTATCAA
 
. : . : . : . : . : . :
JMFS168D05+ CTGTTTGCCACAATATCGGATTCACTTTGCACTACCATTGGGAAAT
JMFS075C05+ CTGTTTGCCACAATATCGGATTCACTTTGCACTACCATTGGGAAAT
JMFS067G12+ GGAATGGGGTTTTACTGTTTGCCACAATATCGGATTCACTTTGCACTACCATTGGGAAAT
                      ____________________________________________________________
consensus GGAATGGGGTTTTACTGTTTGCCACAATATCGGATTCACTTTGCACTACCATTGGGAAAT
 
. : . : . : . : . : . :
JMFS168D05+ ATGATTGTGTAGACTCGGGGTTTTCATAAGAGGGGATGGTGTAGTACTGCTGAGTCCCCA
JMFS075C05+ ATGATTGTGTAGACTCGGGGTTTTCATAAGAGGGGATGGTGTAGTACTGCTGAGTCCCCA
JMFS067G12+ ATGATTGTGTAGACTCGGGGTTTTCATAAGAGGGGATGGTGTAGTACTGCTGAGTCCCCA
                      ____________________________________________________________
consensus ATGATTGTGTAGACTCGGGGTTTTCATAAGAGGGGATGGTGTAGTACTGCTGAGTCCCCA
 
. : . : . : . : . : . :
JMFS168D05+ TATATGAACTGTCAACTCCTACCACAGCACCAGGAGTATACGGGTTATATGGAGACTGTG
JMFS075C05+ TATATGAACTGTCAACTCCTACCACAGCACCAGGAGTATACGGGTTATATGGAGACTGTG
JMFS067G12+ TATATGAACTGTCAACTCCTACCACAGCACCAGGAGTATACGGGTTATATGGAGACTGTG
                      ____________________________________________________________
consensus TATATGAACTGTCAACTCCTACCACAGCACCAGGAGTATACGGGTTATATGGAGACTGTG
 
. : . : . : . : . : . :
JMFS168D05+ CATACCCATAGCTAGGTGTATAATATACATAAGGAAAGCTTTCACTTTGTGCACCCGCAT
JMFS075C05+ CATACCCATAGCTAGGTGTATAATATACATAAGGAAAGCTTTCACTTTGTGCACCCGCAT
JMFS067G12+ CATACCCATAGCTAGGTGTATAATATACATAAGGAAAGCTTTCACTTTGTGCACCCGCAT
                      ____________________________________________________________
consensus CATACCCATAGCTAGGTGTATAATATACATAAGGAAAGCTTTCACTTTGTGCACCCGCAT
 
. : . : . : . : . : . :
JMFS168D05+ AAATTTCTTGACCATCCAGACCAAAAACTCTTTGGTGGTCATCCCAATTGCCGGGCGAAT
JMFS075C05+ AAATTTCTTGACCATCCAGACCAAAAACTCTTTGGTGGTCATCCCAATTGCCGGGCGAAT
JMFS067G12+ AAATTTCTTGACCATCCAGACCAAAAACTCTTTGGTGGTCATCCCAATTGCCGGGCGAAT
                      ____________________________________________________________
consensus AAATTTCTTGACCATCCAGACCAAAAACTCTTTGGTGGTCATCCCAATTGCCGGGCGAAT
 
. : . : . : . : . : . :
JMFS168D05+ CAAATCCTGTACAATAATACCCATAATTGGTGGCAGTAGGATAATACAAACCCTGATCAA
JMFS075C05+ CAAATCCTGTACAATAATACCCATAATTGGTGGCAGTAGGATAATACAAACCCTGATCAA
JMFS067G12+ CAAATCCTGTACAATAATACCCATAATTGGTGGCAGTAGGATAATACAAACCCTGATCAA
                      ____________________________________________________________
consensus CAAATCCTGTACAATAATACCCATAATTGGTGGCAGTAGGATAATACAAACCCTGATCAA
 
. : . : . : . : . : . :
JMFS168D05+ TAACAAACTCAGGAACACCTTCACTATACATAGCTTCAAACCTTTCAAGAATCAGACTGG
JMFS075C05+ TAACAAACTCAGGAACACCTTCACTATACATAGCTTCAAACCTTTCAAGAATCAGACTGG
JMFS067G12+ TAACAAACTCAGGAACACCTTCACTATACATAGCTTCAAACCTTTCAAGAATCAGACTGG
                      ____________________________________________________________
consensus TAACAAACTCAGGAACACCTTCACTATACATAGCTTCAAACCTTTCAAGAATCAGACTGG
 
. : . : . : . : . : . :
JMFS168D05+ TAAAGTGGAGGTTTGTCTCAGTACTTCAATC
JMFS075C05+ TAAAGTGGAGGTTTGTCTCAGTACTTCAATC
JMFS067G12+ TAAAGTGGAGGTTTGTCTCAGTACTTCAATCTCAAGCTATTAAACGGGAGAATTCCTCGT
                      ____________________________________________________________
consensus TAAAGTGGAGGTTTGTCTCAGTACTTCAATCTCAAGCTATTAAACGGGAGAATTCCTCGT
 
. : . : . : . : . : . :
JMFS067G12+ CTTTTCTTTTGATCTCTCGGAAATTTTTCAAAGATGAAGCTCTTGAGGAGGAAAAGAAAA
                      ____________________________________________________________
consensus CTTTTCTTTTGATCTCTCGGAAATTTTTCAAAGATGAAGCTCTTGAGGAGGAAAAGAAAA