Previous Contig 003419:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF039B05Sequence506003419 (3)pir|F84668|F846682e-25hypothetical protein At2g27090 [imported] - Arabidopsis thaliana>gb:AC005623_153692008797 (4)pir|F84668|F846681e-28hypothetical protein At2g27090 [imported] - Arabidopsis thaliana>gb:AC005623_153
JMFS067G04Sequence619003419 (3)pir|F84668|F846684e-29hypothetical protein At2g27090 [imported] - Arabidopsis thaliana>gb:AC005623_153
JMSF018L06Sequence531003419 (3)pir|F84668|F846682e-26hypothetical protein At2g27090 [imported] - Arabidopsis thaliana>gb:AC005623_153710008797 (4)pir|F84668|F846681e-39hypothetical protein At2g27090 [imported] - Arabidopsis thaliana>gb:AC005623_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS067G04+ CCTCCAAATTTCATGTGAT
                      ____________________________________________________________
consensus CCTCCAAATTTCATGTGAT
 
. : . : . : . : . : . :
JMSF018L06+ TCACCGAGATCAACATTGT
JMFS067G04+ TTACATGGTACGTTGGAGGAGGAGACGGCAACAACACATTCTCACCGAGATCAACATTGT
                      ____________________________________________________________
consensus TTACATGGTACGTTGGAGGAGGAGACGGCAACAACACATTCTCACCGAGATCAACATTGT
 
. : . : . : . : . : . :
JMSF018L06+ GTGATTTAGACACCGAAGAGAAGGATCTTTCGGTCAATGCAAACAGTTCAGGCGTGGCGC
JMFF039B05+ CACCGAAGAGAAGGATCTTTCGGTCAATGCAAACAGTTCAGGCGTGGCGN
JMFS067G04+ GTGATTTAGACACCGAAGAGAAGGATCTTTCGGTCAATGCAAACAGTTCAGGCGTGGCGC
                      ____________________________________________________________
consensus GTGATTTAGACACCGAAGAGAAGGATCTTTCGGTCAATGCAAACAGTTCAGGCGTGGCGC
 
. : . : . : . : . : . :
JMSF018L06+ TAGTGGAAGTATAGATTGAAGATTCAATTGGGTGGGGGGCTTCAGGTTCAACAAATTTCC
JMFF039B05+ TAGTGGAAGTATAGATTGAAGATTCAATTGGGTGGGGGGCTTCAGGTTCAACAAATTTCC
JMFS067G04+ TAGTGGAAGTATAGATTGAAGATTCAATTGGGTGGGGGGCTTCAGGTTCAACAAATTTCC
                      ____________________________________________________________
consensus TAGTGGAAGTATAGATTGAAGATTCAATTGGGTGGGGGGCTTCAGGTTCAACAAATTTCC
 
. : . : . : . : . : . :
JMSF018L06+ TCAGAGCAATTCCTGTCATTTTCAATGCCTCTATATAACCAACATGAGTTGCTGCTAAAG
JMFF039B05+ TCAGAGCAATTCCTGTCATTTTCAATGCCTCTATATAACCAACATGAGTTGCTGCTAAAG
JMFS067G04+ TCAGAGCAATTCCTGTCATTTTCAATGCCTCTATATAACCAACATGAGTTGCTGCTAAAG
                      ____________________________________________________________
consensus TCAGAGCAATTCCTGTCATTTTCAATGCCTCTATATAACCAACATGAGTTGCTGCTAAAG
 
. : . : . : . : . : . :
JMSF018L06+ AACACCTCCCATCAAGTGCTTGTCTAACAAATTTTTTCCTTTCTCTGCAAATCTGTAAGG
JMFF039B05+ AACACCTCCCATCAAGTGCTTGTCTAACAAATTTTTTCCTTTCTCTGCAAATCTGTAAGG
JMFS067G04+ AACACCTCCCATCAAGTGCTTGTCTAACAAATTTTTTCCTTTCTCTGCAAATCTGTAAGG
                      ____________________________________________________________
consensus AACACCTCCCATCAAGTGCTTGTCTAACAAATTTTTTCCTTTCTCTGCAAATCTGTAAGG
 
. : . : . : . : . : . :
JMSF018L06+ CTTTATCTTCTTCAACCCTAGAATTAGCAGCCCCCATTAAACTATACCCCAAACTCAACC
JMFF039B05+ CTTTATCTTCTTCAACCCTAGAATTAGCAGCCCCCATTAAACTATACCCCAAACTCAACC
JMFS067G04+ CTTTATCTTCTTCAACCCTAGAATTAGCAGCCCCCATTAAACTATACCCCAAACTCAACC
                      ____________________________________________________________
consensus CTTTATCTTCTTCAACCCTAGAATTAGCAGCCCCCATTAAACTATACCCCAAACTCAACC
 
. : . : . : . : . : . :
JMSF018L06+ CTCTACAATTATCATTAATTCATCTACCAAATCAATAAATTCCTCAACTTCCCCAGGGCT
JMFF039B05+ CTCTACAATTATCATTAATTCATCTACCAAATCAATAAATTCCTCAACTTCCCCAGGGCT
JMFS067G04+ CTCTACAATTATCATTAATTCATCTACCAAATCAATAAATTCCTCAACTTCCCCAGGGCT
                      ____________________________________________________________
consensus CTCTACAATTATCATTAATTCATCTACCAAATCAATAAATTCCTCAACTTCCCCAGGGCT
 
. : . : . : . : . : . :
JMSF018L06+ C
JMFF039B05+ C
JMFS067G04+ CTGTCACAAAATTCAACAACCCAAACATCAACCATATGCATTACAGGGCTAAAACCCAAA
                      ____________________________________________________________
consensus CTGTCACAAAATTCAACAACCCAAACATCAACCATATGCATTACAGGGCTAAAACCCAAA
 
. : . : . : . : . : . :
JMFS067G04+ CAGAAACCACCAAAATAAGAGATTAATGATCCAACAAAGAATTGAAGTCGAACCCAAAAT
                      ____________________________________________________________
consensus CAGAAACCACCAAAATAAGAGATTAATGATCCAACAAAGAATTGAAGTCGAACCCAAAAT
 
. : . : . : . : . : . :
JMFS067G04+ CAGACATAAAAAAAGCAATAACACATATAAGGATATTAATGAGTATTAGCTCAAATTCAA
                      ____________________________________________________________
consensus CAGACATAAAAAAAGCAATAACACATATAAGGATATTAATGAGTATTAGCTCAAATTCAA