Previous Contig 003415:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS067C08Sequence615003415 (3)gb:BT000348_16346263e-48Arabidopsis thaliana Unknown protein (At1g07650) mRNA, complete cds.>gb:AF370513
JMSF011P01Sequence297003415 (3)gb:BT000348_16346261e-07Arabidopsis thaliana Unknown protein (At1g07650) mRNA, complete cds.>gb:AF370513
JMSF018C20Sequence484003415 (3)gb:BT000348_16346264e-30Arabidopsis thaliana Unknown protein (At1g07650) mRNA, complete cds.>gb:AF370513769012004 (2)pir|A86211|A862119e-70hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889771 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS067C08+ TATGCTCAGGTTCCT
                      ____________________________________________________________
consensus TATGCTCAGGTTCCT
 
. : . : . : . : . : . :
JMFS067C08+ GAGAGTAGTGATTCTGGTGAGGACTTTAGGAAATGGTCCCGATAATCGGTTCCCCATAAA
                      ____________________________________________________________
consensus GAGAGTAGTGATTCTGGTGAGGACTTTAGGAAATGGTCCCGATAATCGGTTCCCCATAAA
 
. : . : . : . : . : . :
JMSF018C20+ ACTGTTGTGGTATCGAGCCATTCAGATAATT
JMFS067C08+ GGAGAGTTCAAGCAAGCGCATTGACGCCCACTGTTGTGGTATCGAGCCATTCAGATAATT
                      ____________________________________________________________
consensus GGAGAGTTCAAGCAAGCGCATTGACGCCCACTGTTGTGGTATCGAGCCATTCAGATAATT
 
. : . : . : . : . : . :
JMSF018C20+ GCGGCTGAGATCCAAGATCTTGAGGTGATGGAACTTTGCAAACTCGGGTGGAAGACCAGC
JMFS067C08+ GCGGCTGAGATCCAAGATCTTGAGGTGATGGAACTTTGAAAACTCGGGTGGAAGACCAGC
                      ____________________________________________________________
consensus GCGGCTGAGATCCAAGATCTTGAGGTGATGGAACTTTGCAAACTCGGGTGGAAGACCAGC
 
. : . : . : . : . : . :
JMSF018C20+ TGAAAAATTTTGCGACTTCAGAGCTATGGCAGTGATGTGACAGGTGGCGTTGTTATCAAA
JMFS067C08+ TGAAAAATTTTGCGACTTCAGAGCTATGGCAGTGATGTGACAGGTGGCGTTGTTATCAAA
                      ____________________________________________________________
consensus TGAAAAATTTTGCGACTTCAGAGCTATGGCAGTGATGTGACAGGTGGCGTTGTTATCAAA
 
. : . : . : . : . : . :
JMSF018C20+ AGAGCAATCGCAGGTAACAGTGGTCTCGAAGCTTTTTCTTTGAATTTTGGGGCTCCAGCT
JMSF011P01+ GAATTTNGGGGCTCCAGCT
JMFS067C08+ AGAGCAATCGCAGGTAACAGTGGTCTCGAAGCTTTTTCTTTGAATTTTGGGGCTCCAGCT
                      ____________________________________________________________
consensus AGAGCAATCGCAGGTAACAGTGGTCTCGAAGCTTTTTCTTTGAATTTTGGGGCTCCAGCT
 
. : . : . : . : . : . :
JMSF018C20+ CTCTCCTCCACTGCAAGGATCCTTCCCGAAATCCCAGTCCGTTTTCCCAAGCTTTTTAGC
JMSF011P01+ CTCTCCTCCACTGCAAGGATCCTTCCCGAAATCCCAGTCCGTTTTCCCAANCTTTTTAGC
JMFS067C08+ CTCTCCTCCACTGCAAGGATCCTTCCCGAAATCCCAGTCCGTTTTCCCAAGCTTTTTAGC
                      ____________________________________________________________
consensus CTCTCCTCCACTGCAAGGATCCTTCCCGAAATCCCAGTCCGTTTTCCCAAGCTTTTTAGC
 
. : . : . : . : . : . :
JMSF018C20+ GATCTGTTTAAGTGCTATCACTTCTTCTTGATGGAGCTTGGGGGTGGCAGCTAAAAGAGA
JMSF011P01+ GATCTGTTTAAGTGCTATCACTTCTTCTTGATGGAGCTTGGGGGTGGCAGCTAAAAGAGA
JMFS067C08+ GATCTGTTTAAGTGCTATCACTTCTTCTTGATGGAGCTTGGGGGTGGCAGCTAAAAGAGA
                      ____________________________________________________________
consensus GATCTGTTTAAGTGCTATCACTTCTTCTTGATGGAGCTTGGGGGTGGCAGCTAAAAGAGA
 
. : . : . : . : . : . :
JMSF018C20+ GGGTGAGAGAAGAAGAAGAAGAAGCTCAAGAGAACAGAGGATGCAGAGAAATGGAAGGTT
JMSF011P01+ GGGTGAGAGAAGAAGAAGAAGAAGCTCAAGAGAACAGAGGATGCAGAGAAATGGAAGGNT
JMFS067C08+ GGGTGAGAGAAGAAGAAGAAGAAGCTCAAGAGAACAGAGGATGCAGAGAAATGGAAGGTT
                      ____________________________________________________________
consensus GGGTGAGAGAAGAAGAAGAAGAAGCTCAAGAGAACAGAGGATGCAGAGAAATGGAAGGTT
 
. : . : . : . : . : . :
JMSF018C20+ TCTGGGGAGAAAAGGTGGGTTGAGTTGGGTTTCCATTACTGCAATTCGGGAAGGGAGGTG
JMSF011P01+ TCTGGGGAGAAAAGGTGGGTTGAGTTGGGTTTCCATTACTGCAATTCGGGAAGGGAGGTG
JMFS067C08+ TCTGGGGAGAAAAGGTGGGTTGAGTTGGGTTTCCATTACTGCAATTCGGGAAGGGAGGTG
                      ____________________________________________________________
consensus TCTGGGGAGAAAAGGTGGGTTGAGTTGGGTTTCCATTACTGCAATTCGGGAAGGGAGGTG
 
. : . : . : . : . : . :
JMSF018C20+ AGTGAGCTCAGTCGTTGCCCACTTTGTCT
JMSF011P01+ AGTGAGCTCAGTCGTNGCCCACTTTGTCT
JMFS067C08+ AGTGAGCTCAGTCGTTGCCCACTTTGTCTTTGCCTTTGCCTTTGCCTTTGCCTCAGCTTT
                      ____________________________________________________________
consensus AGTGAGCTCAGTCGTTGCCCACTTTGTCTTTGCCTTTGCCTTTGCCTTTGCCTCAGCTTT