Previous Contig 003400:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002H07Sequence566003670 (18)pir|T01385|T013858e-39probable phosphoprotein phosphatase (EC 3.1.3.16) T4I9.4 - Arabidopsis thaliana>751003400 (9)gb:FSY298828_16794122e-22Fagus sylvatica partial mRNA for protein phosphatase (pp1-1 gene).
JMFF006J23Sequence236003670 (18)767003400 (9)gb:FSY298828_16794121e-52Fagus sylvatica partial mRNA for protein phosphatase (pp1-1 gene).
JMFF014J24Sequence512003670 (18)pir|T01385|T013851e-24probable phosphoprotein phosphatase (EC 3.1.3.16) T4I9.4 - Arabidopsis thaliana>688003400 (9)gb:FSY298828_16794129e-12Fagus sylvatica partial mRNA for protein phosphatase (pp1-1 gene).
JMFN029C22Sequence103003400 (9)
JMFS065H09Sequence624003400 (9)
JMSF008M17Sequence748003400 (9)gb:FSY298828_16794124e-54Fagus sylvatica partial mRNA for protein phosphatase (pp1-1 gene).
JMSF012M20Sequence514003670 (18)pir|T01385|T013853e-36probable phosphoprotein phosphatase (EC 3.1.3.16) T4I9.4 - Arabidopsis thaliana>748003400 (9)gb:FSY298828_16794124e-54Fagus sylvatica partial mRNA for protein phosphatase (pp1-1 gene).
JMSF038P17Sequence662003670 (18)pir|T01385|T013857e-49probable phosphoprotein phosphatase (EC 3.1.3.16) T4I9.4 - Arabidopsis thaliana>863003400 (9)gb:FSY298828_16794123e-55Fagus sylvatica partial mRNA for protein phosphatase (pp1-1 gene).
JMSF050H22Sequence663003670 (18)pir|T01385|T013853e-71probable phosphoprotein phosphatase (EC 3.1.3.16) T4I9.4 - Arabidopsis thaliana>751003400 (9)gb:FSY298828_16794124e-54Fagus sylvatica partial mRNA for protein phosphatase (pp1-1 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF038P17+ GTCTGA
                      ____________________________________________________________
consensus GTCTGA
 
. : . : . : . : . : . :
rJMFF006J23+ GGAAAATGATAGTGTAGAAGGATTGAGACCGAATGCAAGAGGGCCTGGTCTTGT
rJMSF050H22+ CCCACGGAAAATGATAGTGTAGAAGGATTGAGACCGAATGCAAGAGGGCCTGGTCTTGT
rJMSF012M20+ CCCACGGAAAATGATAGTGTAGAAGGATTGAGACCGAATGCAAGAGGGCCTGGTCTTGT
rJMSF008M17+ CCCACGGAAAATGATAGTGTAGAAGGATTGAGACCGAATGCAAGAGGGCCTGGTCTTGT
rJMSF038P17+ TCCCACGGAAAATGATAGTGTAGAAGGATTGAGACCGAATGCAAGAGGGCCTGGTCTTGT
                      ____________________________________________________________
consensus TCCCACGGAAAATGATAGTGTAGAAGGATTGAGACCGAATGCAAGAGGGCCTGGTCTTGT
 
. : . : . : . : . : . :
rJMFF006J23+ GACCTTTGGGCCTGATCGTGTTACAGATTTCTGTAAGAGGAATAAATTGCAATTAATAAT
rJMSF050H22+ GACCTTTGGGCCTGATCGTGTTACAGATTTCTGTAAGAGGAATAAATTGCAATTAATAAT
rJMSF012M20+ GACCTTTGGGCCTGATCGTGTTACAGATTTCTGTAAGAGGAATAAATTGCAATTAATAAT
rJMSF008M17+ GACCTTTGGGCCTGATCGTGTTACAGATTTCTGTAAGAGGAATAAATTGCAATTAATAAT
rJMSF038P17+ GACCTTTGGGCCTGATCGTGTTACAGATTTCTGTAAGAGGAATAAATTGCAATTAATAAT
                      ____________________________________________________________
consensus GACCTTTGGGCCTGATCGTGTTACAGATTTCTGTAAGAGGAATAAATTGCAATTAATAAT
 
. : . : . : . : . : . :
rJMFF006J23+ AAGAGCACATGAGTGTGTTATGGATGGATTTGAACGTTTTGCCCAGGGGCAGTTGATCAC
rJMSF050H22+ AAGAGCACATGAGTGTGTTATGGATGGATTTGAACGTTTTGCCCAGGGGCAGTTGATCAC
rJMSF012M20+ AAGAGCACATGAGTGTGTTATGGATGGATTTGAACGTTTTGCCCAGGGGCAGTTGATCAC
rJMSF008M17+ AAGAGCACATGAGTGTGTTATGGATGGATTTGAACGTTTTGCCCAGGGGCAGTTGATCAC
rJMSF038P17+ AAGAGCACATGAGTGTGTTATGGATGGATTTGAACGTTTTGCCCAGGGGCAGTTGATCAC
rJMFF002H07+ CATGAGTGTGTTATGGATGGATTTGAACGTTTTGCCCAGGGGCAGTTGATCAC
                      ____________________________________________________________
consensus AAGAGCACATGAGTGTGTTATGGATGGATTTGAACGTTTTGCCCAGGGGCAGTTGATCAC
 
. : . : . : . : . : . :
rJMFF006J23+ ACTATTTTCTGCTACTAACTATTGTGGAACTGCCAATAATGCTGGTGCAATACTGGTAGT
rJMSF050H22+ ACTATTTTCTGCTACTAACTATTGTGGAACTGCCAATAATGCTGGTGCAATACTGGTAGT
rJMSF012M20+ ACTATTTTCTGCTACTAACTATTGTGGAACTGCCAATAATGCTGGTGCAATACTGGTAGT
rJMSF008M17+ ACTATTTTCTGCTACTAACTATTGTGGAACTGCCAATAATGCTGGTGCAATACTGGTAGT
rJMSF038P17+ ACTATTTTCTGCTACTAACTATTGTGGAACTGCCAATAATGCTGGTGCAATACTGGTAGT
rJMFF002H07+ ACTATTTTCTGCTACTAACTATTGTGGAACTGCCAATAATGCTGGTGCAATACTGGTAGT
rJMFF014J24+ TACTAACTATTGTGGAACTGCCAAGAATGNTGGTGCAATACTGGTAGT
                      ____________________________________________________________
consensus ACTATTTTCTGCTACTAACTATTGTGGAACTGCCAATAATGCTGGTGCAATACTGGTAGT
 
. : . : . : . : . : . :
rJMFF006J23+ TGGGAGAGGACTTGTTATAGTTCCTAAATTGATTCATCCAT-TGCCACCGCCTCTTCTAT
rJMSF050H22+ TGGGAGAGGACTTGTTATAGTTCCTAAATTGATTCATCCAT-TGCCACCGCCTCTTCTAT
rJMSF012M20+ TGGGAGAGGACTTGTTATAGTTCCTAAATTGATTCATCCAT-TGCCACCGCCTCTTCTAT
rJMSF008M17+ TGGGAGAGGACTTGTTATAGTTCCTAAATTGATTCATCCAT-TGCCACCGCCTCTTCTAT
rJMSF038P17+ TGGGAGAGGACTTGTTATAGTTCCTAAATTGATTCATCCAT-TGCCACCGCCTCTTCTAT
rJMFF002H07+ TGGGAGAGGACTTGTTATAGTTCNTAAATTGATTCATCCAT-TGCCACCGCCTCTTCTAT
rJMFF014J24+ TGGGAGAGGACTTGTTATAGTTCCTAAATTGATTCATCCAT-TGCCACCGCNTCTTCTAT
JMFS065H09- CATCCATGTGTCTTCATTGACCCGTT
                      ____________________________________________________________
consensus TGGGAGAGGACTTGTTATAGTTCCTAAATTGATTCATCCAT-TGCCACCGCCTCTTCTAT
 
. : . : . : . : . : . :
rJMFF006J23+ CCCCAGATACATCTCCAGAACGGGTCAATGAAGACACATGGATGCAGGAACTAAACATTC
rJMSF050H22+ CCCCAGATACATCTCCAGAACGGGTCAATGAAGACACATGGATGCAGGAACTAAACATTC
rJMSF012M20+ CCCCAGATACATCTCCAGAACGGGTCAATGAAGACACATGGATGCAGGAACTAAACATTC
rJMSF008M17+ CCCCAGATACATCTCCAGAACGGGTCAATGAAGACACATGGATGCAGGAACTAAACATTC
rJMSF038P17+ CCCCAGATACATCTCCAGAACGGGTCAATGAAGACACATGGATGCAGGAACTAAACATTC
rJMFF002H07+ CCCCAGATACATCTCCAGAACGGGTCAATGAAGACACATGGATGCAGGAACTAAACATTC
rJMFF014J24+ CCCCAGATACATNTCCAGAACGGGTCAATGAAGACACATGGATGCAGGAACTAAACATTC
JMFS065H09- CTGGAGATGTATCTGGGGATAGAAGAGGCGGTGGCA-ATGGATGCAGGAACTAAACATTC
                      ____________________________________________________________
consensus CCCCAGATACATCTCCAGAACGGGTCAATGAAGACACATGGATGCAGGAACTAAACATTC
 
. : . : . : . : . : . :
rJMFF006J23+ AACGACCACCTACCCCTACTCGTGGTCGCCCTCAGCCTGACCTAGACCGGAACTCACTCG
rJMSF050H22+ AACGACCACCTACCCCTACTCGTGGTCGCCCTCAGCCTGACCTAGACCGGAACTCACTCG
rJMSF012M20+ AACGACCACCTACCCCTACTCGTGGTCGCCCTCAGCCTGACCTAGACCGGAACTCACTCG
rJMSF008M17+ AACGACCACCTACCCCTACTCGTGGTCGCCCTCAGCCTGACCTAGACCGGAACTCACTCG
rJMSF038P17+ AACGACCACCTACCCCTACTCGTGGTCGCCCTCAGCCTGACCTAGACCGGAACTCACTCG
rJMFF002H07+ AACGACCACCTACCCCTACTCGTGGTCGCCCTCAGCCTGACCTAGACCGGAACTCACTCG
rJMFF014J24+ AACGACCACNTACCCNTACTCGTGGTCGCCCTCAGCCTGACNTAGACCGGAACTCACTCG
JMFN029C22+ AGCCTGACCTAGACCGGAACTCACTCG
JMFS065H09- AACGACCACCTACCCCTACTCGTGGTCGCCCTCAGCCTGACCTAGACCGGAACTCACTCG
                      ____________________________________________________________
consensus AACGACCACCTACCCCTACTCGTGGTCGCCCTCAGCCTGACCTAGACCGGAACTCACTCG
 
. : . : . : . : . : . :
rJMFF006J23+ CTTATATATGAGCGGGCATTTCATTGAATACAAGTTCCAATATTCTCCCATTCAGGATTT
rJMSF050H22+ CTTATATATGAGCGGGCATTTCATTGAATACAAGTTCCAATATTCTCCCATTCAGGATTT
rJMSF012M20+ CTTATATATGAGCGGGCATTTCATTGAATACAAGTTCCAATATTCTCCCATTCAGGATTT
rJMSF008M17+ CTTATATATGAGCGGGCATTTCATTGAATACAAGTTCCAATATTCTCCCATTCAGGATTT
rJMSF038P17+ CTTATATATGAGCGGGCATTTCATTGAATACAAGTTCCAATATTCTCCCATTCAGGATTT
rJMFF002H07+ CTTATATATGAGCGGGCATTTCATTGAATACAAGTTCCAATATTCTCCCATTCAGGATTT
rJMFF014J24+ CTTATATATGAGCGGGCATTTCATTGAATACAAGTTCCAATATTCTCCCATTCAGGATTT
JMFN029C22+ CTTATATATGAGCGGGCATTTCATTGAATACAAGTTCCAATATTCTCCCATTCAGGA
JMFS065H09- CTTATATATGAGCGGGCATTTCATTGAATACAAGTTCCAATATTCTCCCATTCAGGATTT
                      ____________________________________________________________
consensus CTTATATATGAGCGGGCATTTCATTGAATACAAGTTCCAATATTCTCCCATTCAGGATTT
 
. : . : . : . : . : . :
rJMFF006J23+ GACAAATTCCTTTCTGAATGGCACATCGTTACAGTTTCAAAGGGAAGTAGTGAAATTGAC
rJMSF050H22+ GACAAATTCCTTTCTGAATGGCACATCGTTACAGTTTCAAAGGGAAGTAGTGAAATTGAC
rJMSF012M20+ GACAAATTCCTTTCTGAATGGCACATCGTTACAGTTTCAAAGGGAAGTAGTGAAATTGAC
rJMSF008M17+ GACAAATTCCTTTCTGAATGGCACATCGTTACAGTTTCAAAGGGAAGTAGTGAAATTGAC
rJMSF038P17+ GACAAATTCCTTTCTGAATGGCACATCGTTACAGTTTCAAAGGGAAGTAGTGAAATTGAC
rJMFF002H07+ GACAAATTCCTTTCTGAATGGCACATCGTTACAGTTTCAAAGGGAAGTAGTGAAATTGAC
rJMFF014J24+ GACAAATTCCTTTNTGAATGGCACATCGTTACAGTTTCAAAGGGAAGTAGTGAAATTGAC
JMFS065H09- GACAAATTCCTTTCTGAATGGCACATCGTTACAGTTTCAAAGGGAAGTAGTGAAATTGAC
                      ____________________________________________________________
consensus GACAAATTCCTTTCTGAATGGCACATCGTTACAGTTTCAAAGGGAAGTAGTGAAATTGAC
 
. : . : . : . : . : . :
rJMFF006J23+ CATATAATGCCATACGAGTAAAAGAACTATTTTATGTTTCGCAAATACAGTTGAGCGGCC
rJMSF050H22+ CATATAATGCCATACGAGTAAAAGAACTATTTTATGTTTCGCAAATACAGTTGAGCGGCC
rJMSF012M20+ CATATAATGCCATACGAGTAAAAGAACTATTTTATGTTTCGCAAATACAGTTGAGCGGCC
rJMSF008M17+ CATATAATGCCATACGAGTAAAAGAACTATTTTATGTTTCGCAAATACAGTTGAGCGGCC
rJMSF038P17+ CATATAATGCCATACGAGTAAAAGAACTATTTTATGTTTCGCAAATACAGTTGAGCGGCC
rJMFF002H07+ CATATAATGCCATACGAGTAAAAGAACTATTTTATGTTTCGCAAATACAGTTGAGCGGCC
rJMFF014J24+ CATATAATGCCATACGAGTAAAAGAACTATTTTATGTTTCGCAAATACAGTTGAGCGGCC
JMFS065H09- CATATAATGCCATACGAGTAAAAGAACTATTTTATGTTTCGCAAATACAGTTGAGCGGCC
                      ____________________________________________________________
consensus CATATAATGCCATACGAGTAAAAGAACTATTTTATGTTTCGCAAATACAGTTGAGCGGCC
 
. : . : . : . : . : . :
rJMFF006J23+ ATGCATGAGTTCTGCGTTGTGAACATAGATAGTGAGATGCAGAAGATGGCAGCTAAGATT
rJMSF050H22+ ATGCATGAGTTCTGCGTTGTGAACATAGATAGTGAGATGCAGAAGATGGCAGCTAAGATT
rJMSF012M20+ ATGCATGAGTTCTGCGTTGTGAACATAGATAGTGAGATGCAGAAGATGGCAGCTAAGATT
rJMSF008M17+ ATGCATGAGTTCTGCGTTGTGAACATAGATAGTGAGATGCAGAAGATGGCAGCTAAGATT
rJMSF038P17+ ATGCATGAGTTCTGCGTTGTGAACATAGATAGTGAGATGCAGAAGATGGCAGCTAAGATT
rJMFF002H07+ ATGCATGAGTTCTGCGTTGTGAACATAGATAGTGAGATGCAGAAGATGGCAGCTAAGATT
rJMFF014J24+ ATGCATGAGTTCTGCGTTGTGAACATAGATAGTGAGATGCAGAAGATGGCAGCTAAGATT
JMFS065H09- ATGCATGAGTTCTGCGTTGTGAACATAGATAGTGAGATGCAGAAGATGGCAGCTAAGATT
                      ____________________________________________________________
consensus ATGCATGAGTTCTGCGTTGTGAACATAGATAGTGAGATGCAGAAGATGGCAGCTAAGATT
 
. : . : . : . : . : . :
rJMFF006J23+ GTGTCGTGTCGAGTGGGGNTGAGTTGTGTATTTCTATTGTAAAAAGCAATAGGTTTTACT
rJMSF050H22+ GTGTCGTGTCGAGTGGGGTTGAGTTGTGTATTTCTATTGTAAAAAGCAATAGGTTTTACT
rJMSF012M20+ GTGTCGTGTCGAGTGGGGTTGAGTTGTGTATTTCTATTGTAAAAAGCAATAGGTTTTACT
rJMSF008M17+ GTGTCGTGTCGAGTGGGGTTGAGTTGTGTATTTCTATTGTAAAAAGCAATAGGTTTTACT
rJMSF038P17+ GTGTCGTGTCGAGTGGGGTTGAGTTGTGTATTTCTATTGTAAAAAGCAATAGGTTTTACT
rJMFF002H07+ GTGTCGTGTCGAGTGGGGTTGAGTTGTGTATTTCTATTGTAAAAAGCAATAGGTTTTACT
rJMFF014J24+ GTGTCGTGTCGAGTGGGGTTGAGTTGTGTATTTCTATTGTAAAAAGCAATAGGTTTTACT
JMFS065H09- GTGTCGTGTCGAGTGGGGTTGAGTTGTGTATTTCTATTGTAAAAAGCAATAGGTTTTACT
                      ____________________________________________________________
consensus GTGTCGTGTCGAGTGGGGTTGAGTTGTGTATTTCTATTGTAAAAAGCAATAGGTTTTACT
 
. : . : . : . : . : . :
rJMFF006J23+ TGTGGAA-CTGATTGATTTGTATTGCGAAGTATATGTTGTTTTAATATTAATATA
rJMSF050H22+ TGTGGAA-CTGATTGATTTGTATTGCGAAGTATA
rJMSF012M20+ TGTGGAA-CTGATTGATTTGTATTGCGAAGT
rJMSF008M17+ TGTGGAACCTGATTGATTTGTATTGCGAAG
rJMSF038P17+ TGTGGAA-CTGATTGATTTGTATTGCGAAGTATATGTTGTTTTAATATTAATATATTATT
rJMFF002H07+ TGTGGAA-CTGATTGATTTGTATTGCGAAGTATATGTTGTTTTAATATTAATATATTATT
rJMFF014J24+ TGTGGAA-CTGATTGATTTGTATTGCGAAGTATATGTTGTTTTAATATTAATATATTATT
JMFS065H09- TGTGGAA-CTGATTGATTTGTATTGCGAAGTATATGTTGTTTTAATATTAATATATTATT
                      ____________________________________________________________
consensus TGTGGAA-CTGATTGATTTGTATTGCGAAGTATATGTTGTTTTAATATTAATATATTATT
 
. : . : . : . : . : . :
rJMSF038P17+ ATATGCACAGAGATGAATAGCCAATGCCATTGATTCAGAGTCTTAGTTTTGGAAGATGTA
rJMFF002H07+ ATATGCACAGAGATGAATAGCCAATGCCATTGATTCAGAGTCTTAGTTTTGGAAGATGTA
rJMFF014J24+ ATATGCACAGAGATGAATAGCCAATGCCATTGATTCAGAGTCTTAGTTTTGGAAGATGTA
JMFS065H09- ATATGCACAGAGATGAATAGCCAATGCCATTGATTCAGAGTCTTAGTTTTGGAAGATGTA
                      ____________________________________________________________
consensus ATATGCACAGAGATGAATAGCCAATGCCATTGATTCAGAGTCTTAGTTTTGGAAGATGTA
 
. : . : . : . : . : . :
rJMSF038P17+ ATGTAATCTTATATTGGGT
rJMFF002H07+ ATGTAATCTTATATTGGGTTGCTTCCCTAGCTAACGAAAT
rJMFF014J24+ ATGTAATCTTATATTGGGTTGCTTCCCTAGCTAACGAAAT
JMFS065H09- ATGTAATCTTATATTGGGTTGCTTCCCTAGCTAACGAAATTTATCAATTTTCAACAATCT
                      ____________________________________________________________
consensus ATGTAATCTTATATTGGGTTGCTTCCCTAGCTAACGAAATTTATCAATTTTCAACAATCT