Previous Contig 003397:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS004A03Sequence582003397 (9)
JMFS058F07Sequence627003397 (9)
JMFS065G11Sequence617003397 (9)
JMFS071C03Sequence624003397 (9)
JMFS085C09Sequence609003397 (9)
JMFS085D09Sequence594003397 (9)
JMFS165H05Sequence590003397 (9)
JMSF036D07Sequence631003397 (9)704013031 (5)gb:AP003455_18297280.003Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P051
JMSF036E23Sequence636003397 (9)690013031 (5)gb:AP003455_18297280.023Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P051

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS071C03+ GCATCATGATGAGGCTTTAATGTAAGAAACCCACGAGTTT
JMFS058F07+ GCATCATGATGAGGCTTTAATGTAAGAAACCCACGAGTTT
                      ____________________________________________________________
consensus GCATCATGATGAGGCTTTAATGTAAGAAACCCACGAGTTT
 
. : . : . : . : . : . :
JMFS071C03+ CTTGACCATCTTTTGAAGATAAAGCATTTCTAGAGTGGGTGGACATAGCAGGGGAGTGAT
JMFS058F07+ CTTGACCATCTTTTGAAGATAAAGCATTTCTAGAGTGGGTGGACATAGCAGGGGAGTGAT
JMSF036E23+ CATCTTTTGAAGATAAAGCATTTCTAGAGTGGGTGGACATAGCAGGGGAGTGAT
JMSF036D07+ CATCTTTTGAAGATAAAGCATTTCTAGAGTGGGTGGACATAGCAGGGGAGTGAT
JMFS085C09+ AGCAGGGGAGTGAT
JMFS165H05+ AGCAGGGGAGTGAT
JMFS085D09+ GGGAGTGAT
JMFS065G11+ GACATAGCAGGGGAGTGAT
                      ____________________________________________________________
consensus CTTGACCATCTTTTGAAGATAAAGCATTTCTAGAGTGGGTGGACATAGCAGGGGAGTGAT
 
. : . : . : . : . : . :
JMFS071C03+ GAGCTGAGCTTTCAATTCTTATGTTCCCTGAACTTGTTCTCAAACTCTCAGTACTATTAG
JMFS058F07+ GAGCTGAGCTTTCAATTCTTATGTTCCCTGAACTTGTTCTCAAACTCTCAGTACTATTAG
JMSF036E23+ GAGCTGAGCTTTCAATTCTTATGTTCCCTGAACTTGTTCTCAAACTCTCAGTACTATTAG
JMSF036D07+ GAGCTGAGCTTTCAATTCTTATGTTCCCTGAACTTGTTCTCAAACTCTCAGTACTATTAG
JMFS085C09+ GAGCTGAGCTTTCAATTCTTATGTTCCCTGAACTTGTTCTCAAACTCTCAGTACTATTAG
JMFS165H05+ GAGCTGAGCTTTCAATTCTTATGTTCCCTGAACTTGTTCTCAAACTCTCAGTACTATTAG
JMFS004A03+ TCTTATGTTCCCTGAAC-GGTTCTCAAACTCTCAGTACTATTAG
JMFS085D09+ GAGCTGAGCTATCAATTCCTATGTTCCCTGAACTTGTTCTCAGACTCTCAGTATTATTAG
JMFS065G11+ GAGCTGAGCTTTCAATTCTTATGTTCCCTGAACTTGTTCTCAAACTCTCAGTACTATTAG
                      ____________________________________________________________
consensus GAGCTGAGCTTTCAATTCTTATGTTCCCTGAACTTGTTCTCAAACTCTCAGTACTATTAG
 
. : . : . : . : . : . :
JMFS071C03+ ACACATTCCCCACTCCAACCGCATCTTCATTCAGTCTAGTTCCATCATTAATTTTCTTGC
JMFS058F07+ ACACATTCCCCACTCCAACCGCATCTTCATTCAGTCTAGTTCCATCATTAATTTTCTTGC
JMSF036E23+ ACACATTCCCCACTCCAACCGCATCTTCATTCAGTCTAGTTCCATCATTAATTTTCTTGC
JMSF036D07+ ACACATTCCCCACTCCAACCGCATCTTCATTCAGTCTAGTTCCATCATTAATTTTCTTGC
JMFS085C09+ ACACATTCCCCACTCCAACCGCATCTTCATTCAGTCTAGTTCCATCATTAATTTTCTTGC
JMFS165H05+ ACACATTCCCCACTCCAACCGCATCTTCATTCAGTCTAGTTCCATCATTAATTTTCTTGC
JMFS004A03+ ACACATTCCCCACTCCAACCGCATCTTCATTCAGTCTAGTTCCATCATTAATTTTCTTGC
JMFS085D09+ TCACATTCCCCACTCCAACCGCATCTTCATTCAGTTTAGTTGCATCATTAATTATCTTGC
JMFS065G11+ ACACATTCCCCACTCCAACCGCATCTTCATTCAGTCTAGTTCCATCATTAATTTTCTTGC
                      ____________________________________________________________
consensus ACACATTCCCCACTCCAACCGCATCTTCATTCAGTCTAGTTCCATCATTAATTTTCTTGC
 
. : . : . : . : . : . :
JMFS071C03+ TCTCAAGGGGATTGGGAGAACTAAGGGCTTGTTGTGCT-TTTTCATTTTGACCAGTTCCA
JMFS058F07+ TCTCAAGGGGATTGGGAGAACTAAGGGCTTGTTGTGCT-TTTTCATTTTGACCAGTTCCA
JMSF036E23+ TCTCAAGGGGATTGGGAGAACTAAGGGCTTGTTGTGCT-TTTTCATTTTGACCAGTTCCA
JMSF036D07+ TCTCAAGGGGATTGGGAGAACTAAGGGCTTGTTGTGCT-TTTTCATTTTGACCAGTTCCA
JMFS085C09+ TCTCAAGGGGATTGGGAGAACTAAGGGCTTGTTGTGCT-TTTTCATTTTGACCAGTTCCA
JMFS165H05+ TCTCAAGGGGATTGGGAGAACTAAGGGCTTGTTGTGCT-TTTTCATTTTGACCAGTTCCA
JMFS004A03+ TCTCAAGGGGATTGGGAGAACTAAGGGCTTGTTGTGCT-TTTTCATTTTGACCAGTTCCA
JMFS085D09+ TCTCAAGGGGATTGGGGGAACTAAGGGCTCGCTGTGCTATTTTCAGTCTGACCAGTTCCA
JMFS065G11+ TCTCAAGGGGATTGGGAGAACTAAGGGCTTGTTGTGCT-TTTTCATTTTGACCAGTTCCA
                      ____________________________________________________________
consensus TCTCAAGGGGATTGGGAGAACTAAGGGCTTGTTGTGCT-TTTTCATTTTGACCAGTTCCA
 
. : . : . : . : . : . :
JMFS071C03+ GTCCATCGTGCTATCCAAACAGATTGAAATGAATACATAGACTGCCCTGTTCTCTCATCA
JMFS058F07+ GTCCATCGTGCTATCCAAACAGATTGAAATGAATACATAGACTGCCCTGTTCTCTCATCA
JMSF036E23+ GTCCATCGTGCTATCCAAACAGATTGAAATGAATACATAGACTGCCCTGTTCTCTCATCA
JMSF036D07+ GTCCATCGTGCTATCCAAACAGATTGAAATGAATACATAGACTGCCCTGTTCTCTCATCA
JMFS085C09+ GTCCATCGTGCTATCCAAACAGATTGAAATGAATACATAGACTGCCCTGTTCTCTCATCA
JMFS165H05+ GTCCATCGTGCTATCCAAACAGATTGAAATGAATACATAGACTGCCCTGTTCTCTCATCA
JMFS004A03+ GTCCATCGTGCTATCCAAACAGATTGAAATGAATACATAGACTGCCCTGTTCTCTCATCA
JMFS085D09+ GTCCATCGTGCTATCCAGTCGGATTGAAATGAATACATAGACTGCCCTGTTCTCTCATCG
JMFS065G11+ GTCCATCGTGCTATCCAAACAGATTGAAATGAATACATAGACTGCCCTGTTCTCTCATCA
                      ____________________________________________________________
consensus GTCCATCGTGCTATCCAAACAGATTGAAATGAATACATAGACTGCCCTGTTCTCTCATCA
 
. : . : . : . : . : . :
JMFS071C03+ CACTC-TTGGTATGATTGTGCTATGCTCTCCGACATGATGTAATGGAATTTGAGGTTGTT
JMFS058F07+ CACTC-TTGGTATGATTGTGCTATGCTCTCCGACATGATGTAATGGAATTTGAGGTTGTT
JMSF036E23+ CACTC-TTGGTATGATTGTGCTATGCTCTCCGACATGATGTAATGGAATTTGAGGTTGTT
JMSF036D07+ CACTC-TTGGTATGATTGTGCTATGCTCTCCGACATGATGTAATGGAATTTGAGGTTGTT
JMFS085C09+ CACTC-TTGGTATGATTGTGCTATGCTCTCCGACATGATGTAATGGAATTTGAGGTTGTT
JMFS165H05+ CACTC-TTGGTATGATTGTGCTATGCTCTCCGACATGATGTAATGGAATTTGAGGTTGTT
JMFS004A03+ CACTC-TTGGTATGATTGTGCTATGCTCTCCGACATGATGTAATGGAATTTGAGGTTGTT
JMFS085D09+ CACTCATTGGTATGATTGTGGTATGCTAGCGGGCATGATGTAATGGGATTTGAGGTTGTT
JMFS065G11+ CACTC-TTGGTATGATTGTGCTATGCTCTCCGACATGATGTAATGGAATTTGAGGTTGTT
                      ____________________________________________________________
consensus CACTC-TTGGTATGATTGTGCTATGCTCTCCGACATGATGTAATGGAATTTGAGGTTGTT
 
. : . : . : . : . : . :
JMFS071C03+ TCCCACTTACAACTACTCTTTTCCCTTCAGATGTTCATGAAAACTTCATTCCTTTGACCT
JMFS058F07+ TCCCACTTACAAATACTCTTTTCCCTTCAGATGTTCATGAAAACTTCATTCCTTTGACCT
JMSF036E23+ TCCCACTTACAACTACTCTTTTCCCTTCAGATGTTCATGAAAACTTCATTCCTTTGACCT
JMSF036D07+ TCCCACTTACAACTACTCTTTTCCCTTCAGATGTTCATGAAAACTTCATTCCTTTGACCT
JMFS085C09+ TCCCACTTACAACTACTCTTTTCCCTTCAGATGTTCATGAAAACTTCATTCCTTTGACCT
JMFS165H05+ TCCCACTTACAACTACTCTTTTCCCTTCAGATGTTCATGAAAACTTCATTCCTTTGACCT
JMFS004A03+ TCCCACTTACAACTACTCTTTTCCCTTCAGATGTTCATGAAAACTTCATTCCTTTGACCT
JMFS085D09+ TCCCACTTGCAACCACTCTTTTCCCTTCAGATGTTCATGAAAACTTCATTCCTTTGACCT
JMFS065G11+ TCCCACTTACAACTACTCTTTTCCCTTCAGATGTTCATGAAAACTTCATTCCTTTGACCT
                      ____________________________________________________________
consensus TCCCACTTACAACTACTCTTTTCCCTTCAGATGTTCATGAAAACTTCATTCCTTTGACCT
 
. : . : . : . : . : . :
JMFS071C03+ CTGATCCTCAATGAAAAGTTGATGGGAACGAGAAAGACGAAAAAGAAGCAAGAGGCGAGG
JMFS058F07+ CTGATCCTCAATGAAAAGTTGATGGGAACGAGAAAGACGAAAAAGAAGCAAGAGGCGAGG
JMSF036E23+ CTGATCCTCAATGAAAAGTTGATGGGAACGAGAAAGACGAAAAAGAAGCAAGAGGCGAGG
JMSF036D07+ CTGATCCTCAATGAAAAGTTGATGGGAACGAGAAAGACGAAAAAGAAGCAAGAGGCGAGG
JMFS085C09+ CTGATCCTCAATGAAAAGTTGATGGGAACGAGAAAGACGAAAAAGAAGCAAGAGGCGAGG
JMFS165H05+ CTGATCCTCAATGAAAAGTTGATGGGAACGAGAAAGACGAAAAAGAAGCAAGAGGCGAGG
JMFS004A03+ CTGATCCTCAATGAAAAGTTGATGGGAACGAGAAAGACGAAAAAGAAGCAAGAGGCGAGG
JMFS085D09+ CTGATCCTCAATGAAAAGTTGATGGGAACGAGAAAGACGAAAAAGAAGCAACAGGCGAGG
JMFS065G11+ CTGATCCTCAATGAAAAGTTGATGGGAACGAGAAAGACGAAAAAGAAGCAAGAGGCGAGG
                      ____________________________________________________________
consensus CTGATCCTCAATGAAAAGTTGATGGGAACGAGAAAGACGAAAAAGAAGCAAGAGGCGAGG
 
. : . : . : . : . : . :
JMFS071C03+ CTGAGCGAGCCGGTAGAAGCCCACATCTAAGGCCTAGGGTTCATCTCCGCCGCGCCGTAC
JMFS058F07+ CTGAGCGAGCCGGTAGAAGCCCACATCTAAGGCCTAGGGTTCATCTCCGCCGCGCCGTAC
JMSF036E23+ CTGAGCGAGCCGGTAGAAGCCCACATCTAAGGCCTAGGGTTCATCTCCGCCGCGCCGTAC
JMSF036D07+ CTGAGCGAGCCGGTAGAAGCCCACATCTAAGGCCTAGGGTTCATCTCCGCCGCGCCGTAC
JMFS085C09+ CTGAGCGAGCCGGTAGAAGCCCACATCTAAGGCCTAGGGTTCATCTCCGCCGCGCCGTAC
JMFS165H05+ CTGAGCGAGCCGGTAGAAGCCCACATCTAAGGCCTAGGGTTCATCTCCGCCGCGCCGTAC
JMFS004A03+ CTGACCGAGCCGGTAGAAGCCCACATCTAAGGCCCAGGGTTCATCTCCGCCGCGCCGTAC
JMFS085D09+ CTGAGCGAGCCGGTATAAGCCCACATCTAAGGCCTAGGGTTCATTTCCGCCGCGCCGTAC
JMFS065G11+ CTGAGCGAGCCGGTAGAAGCCCACATCTAAGGCCTAGGGTTCATCTCCGCCGCGCCGTAC
                      ____________________________________________________________
consensus CTGAGCGAGCCGGTAGAAGCCCACATCTAAGGCCTAGGGTTCATCTCCGCCGCGCCGTAC
 
. : . : . : . : . : . :
JMFS071C03+ ATGCAGATCGGAATTTTCTGATGGATTCTGCGGCGGTGAGGAGTAA
JMFS058F07+ ATGCAGATCGGAATTTTCTGATGGATTCTGCGGCGGTGAGGAGTAAGGA
JMSF036E23+ ATGCAGATCGGAATTTTCTGATGGATTCTGCGGCGGTGAGGAGTAAGGAGTGGAAGAGAG
JMSF036D07+ ATGCAGATCGGAATTTTCTGATGGATTCTGCGGCGGTGAGGAGTAAGGAGTGGAAGAGAG
JMFS085C09+ ATGCAGATCGGAATTTTCTGATGGATTCTGCGGCGGTGAGGAGTAAGGAGTGGAAGAGAG
JMFS165H05+ ATGCAGATCGGAATTTTCTGATGGATTCTGCGGCGGTGAGGAGTAAGGAGTGGAAGAGAG
JMFS004A03+ ATGCAGATCGGAATTTTCTGATGGATTCTGCGGCGGTGAGGAGTAAGGAGTGGAAGAGAG
JMFS085D09+ ATGCAGATCGGAATTTTCTGATGGATTTTGCGGCGGTGAGGAGTAAGGAGTGTAAGAGAG
JMFS065G11+ ATGCAGATCGGAATTTTCTGATGGATTCTGCGGCGGTGAGGAGTAAGGAGTGGAAGAGAG
                      ____________________________________________________________
consensus ATGCAGATCGGAATTTTCTGATGGATTCTGCGGCGGTGAGGAGTAAGGAGTGGAAGAGAG
 
. : . : . : . : . : . :
JMSF036E23+ AGAGAGATGGGGGAGGGAAAAAGGTTAGAGACGACCC
JMSF036D07+ AGAGAGATGGGGGAGGGAAAAAGGTTAGAGACGACCC
JMFS085C09+ AGAGAGATGGGGGAGGGAAAAAGGTTAGAGACGACCCAGAAATGAAAATGGGTTGCA
JMFS165H05+ AGAGAGATGGGGGAGGGAAAAAGGTTAGAGACGACCCA
JMFS004A03+ AGAGAGATGGGGGAGGGAAAAAGGTTAGAGACGACCCAGAAATGAAAATGGGTTGCA
JMFS085D09+ AGAGAGATGGGGGAGGGACAAAGGTTAGAGACGACCCAGAAATGA
JMFS065G11+ AGAGAGATGGGGGAGGGAAAAAGGTTAGAGACGACCCAGAAATGAAAATGGGTTGCAGTT
                      ____________________________________________________________
consensus AGAGAGATGGGGGAGGGAAAAAGGTTAGAGACGACCCAGAAATGAAAATGGGTTGCAGTT