Previous Contig 003393:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS002G05Sequence488003393 (28)gb:AY254349_15930877e-23Nicotiana attenuata lipoxygenase (Lox3) mRNA, complete cds.
JMFS003F02Sequence571003393 (28)gb:AY254349_15930871e-33Nicotiana attenuata lipoxygenase (Lox3) mRNA, complete cds.
JMFS011G11Sequence590003393 (28)gb:AY254349_15930875e-41Nicotiana attenuata lipoxygenase (Lox3) mRNA, complete cds.
JMFS013E08Sequence615003393 (28)gb:AY254349_15930871e-44Nicotiana attenuata lipoxygenase (Lox3) mRNA, complete cds.
JMFS018E01Sequence612003393 (28)gb:AY254349_15930875e-42Nicotiana attenuata lipoxygenase (Lox3) mRNA, complete cds.
JMFS020F04Sequence635003393 (28)gb:AY254349_15930874e-58Nicotiana attenuata lipoxygenase (Lox3) mRNA, complete cds.
JMFS024D08Sequence615003393 (28)gb:AY254349_15930871e-44Nicotiana attenuata lipoxygenase (Lox3) mRNA, complete cds.
JMFS036B09Sequence453003393 (28)gb:AY254349_15930877e-36Nicotiana attenuata lipoxygenase (Lox3) mRNA, complete cds.
JMFS043D02Sequence622003393 (28)gb:AY254349_15930873e-44Nicotiana attenuata lipoxygenase (Lox3) mRNA, complete cds.
JMFS053E03Sequence463003393 (28)gb:AY254349_15930872e-42Nicotiana attenuata lipoxygenase (Lox3) mRNA, complete cds.
JMFS058E12Sequence627003393 (28)gb:AY254349_15930876e-44Nicotiana attenuata lipoxygenase (Lox3) mRNA, complete cds.
JMFS059F07Sequence633003393 (28)gb:AY254349_15930872e-49Nicotiana attenuata lipoxygenase (Lox3) mRNA, complete cds.
JMFS065B12Sequence624003393 (28)gb:AY254349_15930872e-37Nicotiana attenuata lipoxygenase (Lox3) mRNA, complete cds.
JMFS066D11Sequence632003393 (28)gb:AY254349_15930872e-48Nicotiana attenuata lipoxygenase (Lox3) mRNA, complete cds.
JMFS066G03Sequence625003393 (28)gb:AY254349_15930878e-48Nicotiana attenuata lipoxygenase (Lox3) mRNA, complete cds.
JMFS090H12Sequence606003393 (28)gb:AY254349_15930877e-47Nicotiana attenuata lipoxygenase (Lox3) mRNA, complete cds.
JMFS094E05Sequence616003393 (28)gb:AY254349_15930875e-45Nicotiana attenuata lipoxygenase (Lox3) mRNA, complete cds.
JMFS115E01Sequence562003393 (28)gb:AY254349_15930878e-36Nicotiana attenuata lipoxygenase (Lox3) mRNA, complete cds.
JMFS123H08Sequence575003393 (28)gb:AY254349_15930875e-44Nicotiana attenuata lipoxygenase (Lox3) mRNA, complete cds.
JMFS124B03Sequence575003393 (28)gb:AY254349_15930874e-36Nicotiana attenuata lipoxygenase (Lox3) mRNA, complete cds.
JMFS129F09Sequence622003393 (28)gb:AY254349_15930877e-47Nicotiana attenuata lipoxygenase (Lox3) mRNA, complete cds.
JMFS132B04Sequence615003393 (28)gb:AY254349_15930875e-45Nicotiana attenuata lipoxygenase (Lox3) mRNA, complete cds.
JMFS138D04Sequence621003393 (28)gb:AY254349_15930876e-80Nicotiana attenuata lipoxygenase (Lox3) mRNA, complete cds.
JMFS141F06Sequence615003393 (28)gb:AY254349_15930871e-45Nicotiana attenuata lipoxygenase (Lox3) mRNA, complete cds.
JMFS150B07Sequence535003393 (28)gb:AY254349_15930874e-31Nicotiana attenuata lipoxygenase (Lox3) mRNA, complete cds.
JMFS160C07Sequence595003393 (28)gb:AY254349_15930871e-41Nicotiana attenuata lipoxygenase (Lox3) mRNA, complete cds.
JMFS167G10Sequence616003393 (28)gb:AY254349_15930875e-45Nicotiana attenuata lipoxygenase (Lox3) mRNA, complete cds.
JMSF003H16Sequence389003393 (28)gb:AY254349_15930876e-06Nicotiana attenuata lipoxygenase (Lox3) mRNA, complete cds.761004257 (4)pir|T07065|T070653e-69probable lipoxygenase (EC 1.13.11.12) (clone H3) - potato>gb:ST13LH3_1722665 S.t

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS138D04+ T
                      ____________________________________________________________
consensus T
 
. : . : . : . : . : . :
JMFS138D04+ AGTCCGGCAGGTGTCTCGTTGGGCAGATACGGCTGGTTAGAGAAGAATATCCTGCTGTCA
                      ____________________________________________________________
consensus AGTCCGGCAGGTGTCTCGTTGGGCAGATACGGCTGGTTAGAGAAGAATATCCTGCTGTCA
 
. : . : . : . : . : . :
JMFS138D04+ GGGTGGTTTTTCTTGGATTGAACCCAAGAATTGCAAGGGAAATGGACTGTACCACATGCA
JMFS020F04+ TGTACCACATGCA
                      ____________________________________________________________
consensus GGGTGGTTTTTCTTGGATTGAACCCAAGAATTGCAAGGGAAATGGACTGTACCACATGCA
 
. : . : . : . : . : . :
JMFS138D04+ AACCCTTCAATGGTGATGCTCTCCAGGAAGAACTCTTGCTGGTGCTTGTTGGTGACTGTG
JMFS020F04+ AACCCTTCAATGGTGATGCTCTCCAGGAAGAACTCTTGCTGGTGCTTGTTGGTGACTGTG
JMFS066G03+ TGGTGCTTGTTGGTGACTGTG
JMFS129F09+ TGCTTGTTGGTGACTGTG
JMFS141F06+ TGGTGACTGTG
JMFS090H12+ GCTTGTTGGTGACTGTG
JMFS059F07+ TGCTGGTGCTTGTTGGTGACTGTG
JMFS167G10+ TGACTGTG
JMFS132B04+ TGACTGTG
JMFS066D11+ TGCTGGTGCTTGTTGGTGACTGTG
JMFS024D08+ ACTGTG
JMFS123H08+ GTG
JMFS013E08+ ACTGTG
JMFS094E05+ GACTGTG
JMFS043D02+ TGACTGTG
JMFS058E12+ G
                      ____________________________________________________________
consensus AACCCTTCAATGGTGATGCTCTCCAGGAAGAACTCTTGCTGGTGCTTGTTGGTGACTGTG
 
. : . : . : . : . : . :
JMFS138D04+ ATTGCACCAGGGACCCCAAAGTTGGAATCCACCACAAACTCTGCAATGTAATTCACTCTC
JMFS020F04+ ATTGCACCAGGGACCCCAAAGTTGGAATCCACCACAAACTCTGCAATGTAATTCACTCTC
JMFS066G03+ ATTGCACCAGGGACCCCAAAGTTGGAATCCACCACAAACTCTGCAATGTAATTCACTCTC
JMFS129F09+ ATTGCACCAGGGACCCCAAAGTTGGAATCCACCACAAACTCTGCAATGTAATTCACTCTC
JMFS141F06+ ATTGCACCAGGGACCCCAAAGTTGGAATCCACCACAAACTCTGCAATGTAATTCACTCTC
JMFS090H12+ ATTGCACCAGGGACCCCAAAGTTGGAATCCACCACAAACTCTGCAATGTAATTCACTCTC
JMFS059F07+ ATTGCACCAGGGACCCCAAAGTTGGAATCCACCACAAACTCTGCAATGTAATTCACTCTC
JMFS167G10+ ATTGCACCAGGGACCCCAAAGTTGGAATCCACCACAAACTCTGCAATGTAATTCACTCTC
JMFS132B04+ ATTGCACCAGGGACCCCAAAGTTGGAATCCACCACAAACTCTGCAATGTAATTCACTCTC
JMFS066D11+ ATTGCACCAGGGACCCCAAAGTTGGAATCCACCACAAACTCTGCAATGTAATTCACTCTC
JMFS024D08+ ATTGCACCAGGGACCCCAAAGTTGGAATCCACCACAAACTCTGCAATGTAATTCACTCTC
JMFS160C07+ CCCAAAGTTGGAATCCACCACAAACTCTGCAATGTAATTCACTCTC
JMFS011G11+ CCCCAAAGTTGGAATCCACCACAAACTCTGCAATGTAATTCACTCTC
JMFS123H08+ ATTGCACCAGGGACCCCAAAGTTGGAATCCACCACAAACTCTGCAATGTAATTCACTCTC
JMFS115E01+ AATGTAATTCACTCTC
JMFS053E03+ CAGGGACCCCAAAGTTGGAATCCACCACAAACTCTGCAATGTAATTCACTCTC
JMFS013E08+ ATTGCACCAGGGACCCCAAAGTTGGAATCCACCACAAACTCTGCAATGTAATTCACTCTC
JMFS094E05+ ATTGCACCAGGGACCCCAAAGTTGGAATCCACCACAAACTCTGCAATGTAATTCACTCTC
JMFS124B03+ TCTGCAATGTAATTCACTCTC
JMFS036B09+ AATGTAATTCACTCTC
JMFS043D02+ ATTGCACCAGGGACCCCANAGTTGGAATCCACCACAAACTCTGCAATGTAATTCACTCTC
JMFS018E01+ AGGGACCCCAAAGTTGGAATCCAACACAAACTCTGCAATGTAATTCACTCTC
JMFS058E12+ ATTGCACCAGGGACCCCAAAGTTGGAATCCACCACAAACTCTGCAATGTAATTCACTCTC
JMFS003F02+ TCTC
JMFS065B12+ AAACTCTGCAATGTAATTCACTCTC
                      ____________________________________________________________
consensus ATTGCACCAGGGACCCCAAAGTTGGAATCCACCACAAACTCTGCAATGTAATTCACTCTC
 
. : . : . : . : . : . :
JMFS138D04+ TCTGTCTTTAGATTTGACTTCTTGGACCAATCCTTTAACACCGCTGGCTTGCTCTTGTGT
JMFS020F04+ TCTGTCTTTAGATTTGACTTCTTGGACCAATCCTTTAACACCGCTGGCTTGCTCTTGTGT
JMFS066G03+ TCTGTCTTTAGATTTGACTTCTTGGACCAATCCTTTAACACCGCTGGCTTGCTCTTGTGT
JMFS129F09+ TCTGTCTTTAGATTTGACTTCTTGGACCAATCCTTTAACACCGCTGGCTTGCTCTTGTGT
JMFS141F06+ TCTGTCTTTAGATTTGACTTCTTGGACCAATCCTTTAACACCGCTGGCTTGCTCTTGTGT
JMFS090H12+ TCTGTCTTTAGATTTGACTTCTTGGACCAATCCTTTAACACCGCTGGCTTGCTCTTGTGT
JMFS059F07+ TCTGTCTTTAGATTTGACTTCTTGGACCAATCCTTTAACACCGCTGGCTTGCTCTTGTGT
JMFS167G10+ TCTGTCTTTAGATTTGACTTCTTGGACCAATCCTTTAACACCGCTGGCTTGCTCTTGTGT
JMFS132B04+ TCTGTCTTTAGATTTGACTTCTTGGACCAATCCTTTAACACCGCTGGCTTGCTCTTGTGT
JMFS066D11+ TCTGTCTTTAGATTTGACTTCTTGGACCAATCCTTTAACACCGCTGGCTTGCTCTTGTGT
JMFS024D08+ TCTGTCTTTAGATTTGACTTCTTGGACCAATCCTTTAACACCGCTGGCTTGCTCTTGTGT
JMFS160C07+ TCTGTCTTTAGATTTGACTTCTTGGACCAATCCTTTAACACCGCTGGCTTGCTCTTGTGT
JMFS011G11+ TCTGTCTTTAGATTTGACTTCTTGGACCAATCCTTTAACACCGCTGGCTTGCTCTTGTGT
JMFS123H08+ TCTGTCTTTAGATTTGACTTCTTGGACCAATCCTTTAACACCGCTGGCTTGCTCTTGTGT
JMFS115E01+ TCTGTCTTTAGATTTGACTTCTTGGACCAATCCTTTAACACCGCTGGCTTGCTCTTGTGT
JMFS150B07+ AGATTTGACTTCTTGGACCAATCCTTTAACACCGCTGGCTTGCTCTTGTGT
JMFS053E03+ TCTGTCTTTAGATTTGACTTCTTGGACCAATCCTTTAACACCGCTGGCTTGCTCTTGTGT
JMFS013E08+ TCTGTCTTTAGATTTGACTTCTTGGACCAATCCTTTAACACCGCTGGCTTGCTCTTGTGT
JMFS094E05+ TCTGTCTTTAGATTTGACTTCTTGGACCAATCCTTTAACACCGCTGGCTTGCTCTTGTGT
JMFS124B03+ TCTGTCTTTAGATTTGACTTCTTGGACCAATCCTTTAACACCGCTGGCTTGCTCTTGTGT
JMFS036B09+ TCTGTCTTTAGATTTGACTTCTTGGACCAATCCTTTAACACCGCTGGCTTGCTCTTGTGT
JMFS043D02+ TCTGTCTTTAGATTTGACTTCTTGGACCAATCCTTTAACACCGCTGGCTTGCTCTTGTGT
JMFS018E01+ TCTGTCTTTAGATTTGACTTCTTGGACCAATCCTTTAACACCGCTGGCTGGCTCTTGTGT
JMFS058E12+ TCTGTCTTTAGATTTGACTTCTTGGACCAATCCTTTAACACCGCTGGCTTGCTCTTGTGT
JMFS003F02+ TCTGTCTTTAGATTTGACTTCTTGGACCAATCCTTTAACACCGCTGGCTTGCTCTTGTGT
JMFS065B12+ TCTGTCTTTAGATTTGACTTCTTGGACCAATCCTTTAACACCGCTGGCTTGCTCTTGTGT
                      ____________________________________________________________
consensus TCTGTCTTTAGATTTGACTTCTTGGACCAATCCTTTAACACCGCTGGCTTGCTCTTGTGT
 
. : . : . : . : . : . :
JMFS138D04+ GGCCCCTTGCTTTTTGGATCAATTTCAGAGCTGATGAGCTCCATCACAACATTTCTGCCA
JMFS020F04+ GGCCCCTTGCTTTTTGGATCAATTTCAGAGCTGATGAGCTCCATCACAACATTTCTGCCA
JMFS066G03+ GGCCCCTTGCTTTTTGGATCAATTTCAGAGCTGATGAGCTCCATCACAACATTTCTGCCA
JMFS129F09+ GGCCCCTTGCTTTTTGGATCAATTTCAGAGCTGATGAGCTCCATCACAACATTTCTGCCA
JMFS141F06+ GGCCCCTTGCTTTTTGGATCAATTTCAGAGCTGATGAGCTCCATCACAACATTTCTGCCA
JMFS090H12+ GGCCCCTTGCTTTTTGGATCAATTTCAGAGCTGATGAGCTCCATCACAACATTTCTGCCA
JMFS059F07+ GGCCCCTTGCTTTTTGGATCAATTTCAGAGCTGATGAGCTCCATCACAACATTTCTGCCA
JMFS167G10+ GGCCCCTTGCTTTTTGGATCAATTTCAGAGCTGATGAGCTCCATCACAACATTTCTGCCA
JMFS132B04+ GGCCCCTTGCTTTTTGGATCAATTTCAGAGCTGATGAGCTCCATCACAACATTTCTGCCA
JMFS066D11+ GGCCCCTTGCTTTTTGGATCAATTTCAGAGCTGATGAGCTCCATCACAACATTTCTGCCA
JMFS024D08+ GGCCCCTTGCTTTTTGGATCAATTTCAGAGCTGATGAGCTCCATCACAACATTTCTGCCA
JMFS160C07+ GGCCCCTTGCTTTTTGGATCAATTTCAGAGCTGATGAGCTCCATCACAACATTTCTGCCA
JMFS011G11+ GGCCCCTTGCTTTTTGGATCAATTTCAGAGCTGATGAGCTCCATCACAACATTTCTGCCA
JMFS123H08+ GGCCCCTTGCTTTTTGGATCAATTTCAGAGCTGATGAGCTCCATCACAACATTTCTGCCA
JMFS115E01+ GGCCCCTTGCTTTTTGGATCAATTTCAGAGCTGATGAGCTCCATCACAACATTTCTGCCA
JMFS150B07+ GGCCCCTTGCTTTTTGGATCAATTTCAGAGCTGATGAGCTCCATCACAACATTTCTGCCA
JMFS053E03+ GGCCCCTTGCTTTTTGGATCAATTTCAGAGCTTATGAGCTCCATCACAACATTTCTGCCA
JMFS013E08+ GGCCCCTTGCTTTTTGGATCAATTTCAGAGCTGATGAGCTCCATCACAACATTTCTGCCA
JMFS094E05+ GGCCCCTTGCTTTTTGGATCAATTTCAGAGCTGATGAGCTCCATCACAACATTTCTGCCA
JMFS124B03+ GGCCCCTTGCTTTTTGGATCAATTTCAGAGCTGATGAGCTCCATCACAACATTTCTGCCA
JMFS002G05+ GCCCCTTGCTTTTTGGATCAATTTCAGAGCTGATGAGCTCCATCACAACATTTCTGCCA
JMFS036B09+ GGCCCCTTGCTTTTTGGATCAATTTCAGAGCTGATGAGCTCCATCACAACATTTCTGCCA
JMFS043D02+ GGCCCCTTGCTTTTTGGATCAATTTCAGAGCTGATGAGCTCCATCACAACATTTCTGCCA
JMFS018E01+ GGCCCCTTGCTTTTTGGATCAATTTCAGAGCTGATGAGCTCCATCACAACATTTCTGCCA
JMFS058E12+ GGCCCCTTGCTTTTTGGATCAATTTCAGAGCTGATGAGCTCCATCACAACATTTCTGCCA
JMFS003F02+ GGCCCCTTGCTTTTTGGATCAATTTCAGAGCTGATGAGCTCCATCACAACATTTCTGCCA
JMFS065B12+ GGCCCCTTGCTTTTTGGATCAATTTCAGAGCTGATGAGCTCCATCACAACATTTCTGCCA
                      ____________________________________________________________
consensus GGCCCCTTGCTTTTTGGATCAATTTCAGAGCTGATGAGCTCCATCACAACATTTCTGCCA
 
. : . : . : . : . : . :
JMFS138D04+ AAACTTTCAGAGAGATTATCAAGATGCTTGACGAAAGTTTCCTTAAAATCTTCATTGTCC
JMFS020F04+ AAACTTTCAGAGAGATTATCAAGATGCTTGACGAAAGTTTCCTTAAAATCTTCATTGTCC
JMFS066G03+ AAACTTTCAGAGAGATTATCAAGATGCTTGACGAAAGTTTCCTTAAAATCTTCATTGTCC
JMFS129F09+ AAACTTTCAGAGAGATTATCAAGATGCTTGACGAAAGTTTCCTTAAAATCTTCATTGTCC
JMFS141F06+ AAACTTTCAGAGAGATTATCAAGATGCTTGACGAAAGTTTCCTTAAAATCTTCATTGTCC
JMFS090H12+ AAACTTTCAGAGAGATTATCAAGATGCTTGACGAAAGTTTCCTTAAAATCTTCATTGTCC
JMFS059F07+ AAACTTTCAGAGAGATTATCAAGATGCTTGACGAAAGTTTCCTTAAAATCTTCATTGTCC
JMFS167G10+ AAACTTTCAGAGAGATTATCAAGATGCTTGACGAAAGTTTCCTTAAAATCTTCATTGTCC
JMFS132B04+ AAACTTTCAGAGAGATTATCAAGATGCTTGACGAAAGTTTCCTTAAAATCTTCATTGTCC
JMFS066D11+ AAACTTTCAGAGAGATTATCAAGATGCTTGACGAAAGTTTCCTTAAAATCTTCATTGTCC
JMFS024D08+ AAACTTTCAGAGAGATTATCAAGATGCTTGACGAAAGTTTCCTTAAAATCTTCATTGTCC
JMFS160C07+ AAACTTTCAGAGAGATTATCAAGATGCTTGACGAAAGTTTCCTTAAAATCTTCATTGTCC
JMFS011G11+ AAACTTTCAGAGAGATTATCAAGATGCTTGACGAAAGTTTCCTTAAAATCTTCATTGTCC
JMFS123H08+ AAACTTTCAGAGAGATTATCAAGATGCTTGACGAAAGTTTCCTTAAAATCTTCATTGTCC
JMFS115E01+ AAACTTTCAGAGAGATTATCAAGATGCTTGACGAAAGTTTCCTTAAAATCTTCATTGTCC
JMFS150B07+ AAACTTTCAGAGAGATTATCAAGATGCTTGACGAAAGTTTCCTTAAAATCTTCATTGTCC
JMFS053E03+ AAACTTTCAGAGAGATTATCAAGATGCTTGACGAAAGTTTCCTTAAAATCTTCATTGTCC
JMFS013E08+ AAACTTTCAGAGAGATTATCAAGATGCTTGACGAAAGTTTCCTTAAAATCTTCATTGTCC
JMFS094E05+ AAACTTTCAGAGAGATTATCAAGATGCTTGACGAAAGTTTCCTTAAAATCTTCATTGTCC
JMFS124B03+ AAACTTTCAGAGAGATTATCAAGATGCTTGACGAAAGTTTCCTTAAAATCTTCATTGTCC
JMFS002G05+ AAACTTTCAGAGAGATTATCAAGATGCTTGACGAAAGTTTCCTTAAAATCTTCATTGTCC
JMFS036B09+ AAACTTTCAGAGAGATTATCAAGATGCTTGACGAAAGTTTCCTTAAAATCTTCATTGTCC
JMFS043D02+ AAACTTTCAGAGAGATTATCAAGATGCTTGACGAAAGTTTCCTTAAAATCTTCATTGTCC
JMFS018E01+ AAACTTTCAGAGAGATTATCAAGATGCTTGACGAAAGTTTCCTTAAAATCTTCATTGTCC
JMFS058E12+ AAACTTTCAGAGAGATTATCAAGATGCTTGACGAAAGTTTCCTTAAAATCTTCATTGTCC
JMFS003F02+ AAACTTTCAGAGAGATTATCAAGATGCTTGACGAAAGTTTCCTTAAAATCTTCATTGTCC
JMFS065B12+ AAACTTTCAGAGAGATTATCAAGATGCTTGACGAAAGTTTCCTTAAAATCTTCATTGTCC
                      ____________________________________________________________
consensus AAACTTTCAGAGAGATTATCAAGATGCTTGACGAAAGTTTCCTTAAAATCTTCATTGTCC
 
. : . : . : . : . : . :
JMFS138D04+ TTGTTCCTCACAGTCACCACAGCTCTAACCTTAAACTTCACACCTTTCTCCGGCACAATC
JMFS020F04+ TTGTTCCTCACAGTCACCACAGCTCTAACCTTAAACTTCACACCTTTCTCCGGCACAATC
JMFS066G03+ TTGTTCCTCACAGTCACCACAGCTCTAACCTTAAACTTCACACCTTTCTCCGGCACAATC
JMFS129F09+ TTGTTCCTCACAGTCACCACAGCTCTAACCTTAAACTTCACACCTTTCTCCGGCACAATC
JMFS141F06+ TTGTTCCTCACAGTCACCACAGCTCTAACCTTAAACTTCACACCTTTCTCCGGCACAATC
JMFS090H12+ TTGTTCCTCACAGTCACCACAGCTCTAACCTTAAACTTCACACCTTTCTCCGGCACAATC
JMFS059F07+ TTGTTCCTCACAGTCACCACAGCTCTAACCTTAAACTTCACACCTTTCTCCGGCACAATC
JMFS167G10+ TTGTTCCTCACAGTCACCACAGCTCTAACCTTAAACTTCACACCTTTCTCCGGCACAATC
JMFS132B04+ TTGTTCCTCACAGTCACCACAGCTCTAACCTTAAACTTCACACCTTTCTCCGGCACAATC
JMFS066D11+ TTGTTCCTCACAGTCACCACAGCTCTAACCTTAAACTTCACACCTTTCTCCGGCACAATC
JMFS024D08+ TTGTTCCTCACAGTCACCACAGCTCTAACCTTAAACTTCACACCTTTCTCCGGCACAATC
JMFS160C07+ TTGTTCCTCACAGTCACCACAGCTCTAACCTTAAACTTCACACCTTTCTCCGGCACAATC
JMFS011G11+ TTGTTCCTCACAGTCACCACAGCTCTAACCTTAAACTTCACACCTTTCTCCGGCACAATG
JMFS123H08+ TTGTTCCTCACAGTCACCACAGCTCTAACCTTAAACTTCACACCTTTCTCCGGCACAATC
JMFS115E01+ TTGTTCCTCACAGTCACCACAGCTCTAACCTTAAACTTCACACCTTTCTCCGGCACAATC
JMFS150B07+ TTGTTCCTCACAGTCACCACAGCTCTAACCTTAAACTTCACACCTTTCTCCGGCACAATC
JMFS053E03+ TTGTTCCTCACAGTCACCACAGCTCTAACCTTAAACTTCACACCTTTCTCCGGCACAATC
JMFS013E08+ TTGTTCCTCACAGTCACCACAGCTCTAACCTTAAACTTCACACCTTTCTCCGGCACAATC
JMFS094E05+ TTGTTCCTCACAGTCACCACAGCTCTAACCTTAAACTTCACACCTTTCTCCGGCACAATC
JMFS124B03+ TTGTTCCTCACAGTCACCACAGCTCTAACCTTAAACTTCACACCTTTCTCCGGCACAATC
JMFS002G05+ TTGTTCCTCACAGTCACCACAGCTCTAACCTTAAACTTCACACCTTTCTCCGGCACAATC
JMFS036B09+ TTGTTCCTCACAGTCACCACAGCTCTAACCTTAAACTTCACACCTTTCTCCGGCACAATC
JMFS043D02+ TTGTTCCTCACAGTCACCACAGCTCTAACCTTAAACTTCACACCTTTCTCCGGCACAATC
JMFS018E01+ TTGTTCCTCACAGTCACCACAGCTCTAACCTTAAACTTCACACCTTTCTCCGGCACAATC
JMFS058E12+ TTGTTCCTCACAGTCACCACAGCTCTAACCTTAAACTTCACACCTTTCTCCGGCACAATC
JMFS003F02+ TTGTTCCTCACAGTCACCACAGCTCTAACCTTAAACTTCACACCTTTCTCCGGCACAATC
JMSF003H16+ CACAGTCACCACAGCTCTAACCTTAAACTTCACACCTTTCTCCGGCACAATC
JMFS065B12+ TTGTTCCTCACAGTCACCACAGCTCTAACCTTAAACTTCACACCTTTCTCCGGCACAATC
                      ____________________________________________________________
consensus TTGTTCCTCACAGTCACCACAGCTCTAACCTTAAACTTCACACCTTTCTCCGGCACAATC
 
. : . : . : . : . : . :
JMFS138D04+ TTCACCACTTTCTGCTCGCTGCTCACGGCTGCCACCGGTCTAACCCTCTTCACTTGCAGG
JMFS020F04+ TTCACCACTTTCTGCTCGCTGCTCACGGCTGCCACCGGTCTAACCCTCTTCACTTGCAGG
JMFS066G03+ TTCACCACTTTCTGCTCGCTGCTCACGGCTGCCACCGGTCTAACCCTCTTCACTTGCAGG
JMFS129F09+ TTCACCACTTTCTGCTCGCTGCTCACGGCTGCCACCGGTCTAACCCTCTTCACTTGCAGG
JMFS141F06+ TTCACCACTTTCTGCTCGCTGCTCACGGCTGCCACCGGTCTAACCCTCTTCACTTGCAGG
JMFS090H12+ TTCACCACTTTCTGCTCGCTGCTCACGGCTGCCACCGGTCTAACCCTCTTCACTTGCAGG
JMFS059F07+ TTCACCACTTTCTGCTCGCTGCTCACGGCTGCCACCGGTCTAACCCTCTTCACTTGCAGG
JMFS167G10+ TTCACCACTTTCTGCTCGCTGCTCACGGCTGCCACCGGTCTAACCCTCTTCACTTGCAGG
JMFS132B04+ TTCACCACTTTCTGCTCGCTGCTCACGGCTGCCACCGGTCTAACCCTCTTCACTTGCAGG
JMFS066D11+ TTCACCACTTTCTGCTCGCTGCTCACGGCTGCCACCGGTCTAACCCTCTTCACTTGCAGG
JMFS024D08+ TTCACCACTTTCTGCTCGCTGCTCACGGCTGCCACCGGTCTAACCCTCTTCACTTGCAGG
JMFS160C07+ TTCACCACTTTCTGCTCGCTGCTCACGGCTGCCACCGGTCTAACCCTCTTCACTTGCAGG
JMFS011G11+ TTCACCACTTTCTGCTCGCTGCTCACGGCTGCCACCGGTCTAACCCTCTTCACTTGCAGG
JMFS123H08+ TTCACCACTTTCTGCTCGCTGCTCACGGCTGCCACCGGTCTAACCCTCTTCACTTGCAGG
JMFS115E01+ TTCACCACTTTCTGCTCGCTGCTCACGGCTGCCACCGGTCTAACCCTCTTCACTTGCAGG
JMFS150B07+ TTCACCACTTTCTGCTCGCTGCTCACGGCTGCCACCGGTCTAACCCTCTTCACTTGCAGG
JMFS053E03+ TTCACCACTTTCTGCTCGCTGCTCACGGCTGCCACCGGTCTAACCCTCTTCACTTGCAGG
JMFS013E08+ TTCACCACTTTCTGCTCGCTGCTCACGGCTGCCACCGGTCTAACCCTCTTCACTTGCAGG
JMFS094E05+ TTCACCACTTTCTGCTCGCTGCTCACGGCTGCCACCGGTCTAACCCTCTTCACTTGCAGG
JMFS124B03+ TTCACCACTTTCTGCTCGCTGCTCACGGCTGCCACCGGTCTAACCCTCTTCACTTGCAGG
JMFS002G05+ TTCACCACTTTCTGCTCGCTGCTCACGGCTGCCACCGGTCTAACCCTCTTCACTTGCAGG
JMFS036B09+ TTCACCACTTTCTGCTCGCTGCTCACGGCTGCCACCGGTCTAACCCTCTTCACTTGCAGG
JMFS043D02+ TTCACCACTTTCTGCTCGCTGCTCACGGCTGCCACCGGTCTAACCCTCTTCACTTGCAGG
JMFS018E01+ TTCACCACTTTCTGCTCGCTGCTCACGGCTGCCACCGGTCTAACCCTCTTCACTTGCAGG
JMFS058E12+ TTCACCACTTTCTGCTCGCTGCTCACGGCTGCCACCGGTCTAACCCTCTTCACTTGCAGG
JMFS003F02+ TTCACCACTTTCTGCTCGCTGCTCACGGCTGCCACCGGTCTAACCCTCTTCACTTGCAGG
JMSF003H16+ TTCACCACTTTCTGCTCGCTGCTCACGGCTGCCACCGGTCTAACCCTCTTCACTTGCAGG
JMFS065B12+ TTCACCACTTTCTGCTCGCTGCTCACGGCTGCCACCGGTCTAACCCTCTTCACTTGCAGG
                      ____________________________________________________________
consensus TTCACCACTTTCTGCTCGCTGCTCACGGCTGCCACCGGTCTAACCCTCTTCACTTGCAGG
 
. : . : . : . : . : . :
JMFS138D04+ CCCCTTCTCCCCAGCGGATCAACAACCCGGTTCACGCGCAACTGCCCATCAAGATCCGCT
JMFS020F04+ CCCCTTCTCCCCAGCGGATCAACAACCCGGTTCACGCGCAACTGCCCATCAAGATCCGCT
JMFS066G03+ CCCCTTCTCCCCAGCGGATCAACAACCCGGTTCACGCGCAACTGCCCATCAAGATCCGCT
JMFS129F09+ CCCCTTCTCCCCAGCGGATCAACAACCCGGTTCACGCGCAACTGCCCATCAAGATCCGCT
JMFS141F06+ CCCCTTCTCCCCAGCGGATCAACAACCCGGTTCACGCGCAACTGCCCATCAAGATCCGCT
JMFS090H12+ CCCCTTCTCCCCAGCGGATCAACAACCCGGTTCACGCGCAACTGCCCATCAAGATCCGCT
JMFS059F07+ CCCCTTCTCCCCAGCGGATCAACAACCCGGTTCACGCGCAACTGCCCATCAAGATCCGCT
JMFS167G10+ CCCCTTCTCCCCAGCGGATCAACAACCCGGTTCACGCGCAACTGCCCATCAAGATCCGCT
JMFS132B04+ CCCCTTCTCCCCAGCGGATCAACAACCCGGTTCACGCGCAACTGCCCATCAAGATCCGCT
JMFS066D11+ CCCCTTCTCCCCAGCGGATCAACAACCCGGTTCACGCGCAACTGCCCATCAAGATCCGCT
JMFS024D08+ CCCCTTCTCCCCAGCGGATCAACAACCCGGTTCACGCGCAACTGCCCATCAAGATCCGCT
JMFS160C07+ CCCCTTCTCCCCAGCGGATCAACAACCCGGTTCACGCGCAACTGCCCATCAAGATCCGCT
JMFS011G11+ CCCCTTCTCCCCAGCGGATCAACAACCCGGTTCACGCGCAACTGCCCATCAAGATCCGCT
JMFS123H08+ CCCCTTCTCCCCAGCGGATCAACAACCCGGTTCACGCGCAACTGCCCATCAAGATCCGCT
JMFS115E01+ CCCCTTCTCCCCAGCGGATCAACAACCCGGTTCACGCGCAACTGCCCATCAAGATCCGCT
JMFS150B07+ CCCCTTCTCCCCAGCGGATCAACAACCCGGTTCACGCGCAACTGCCCATCAAGATCCGCT
JMFS053E03+ CCCCTTCTCCCCAGCGGATCAACAACCCGGTTCACGCGCAACTGCCCATCAAGATCCGCT
JMFS013E08+ CCCCTTCTCCCCAGCGGATCAACAACCCGGTTCACGCGCAACTGCCCATCAAGATCCGCT
JMFS094E05+ CCCCTTCTCCCCAGCGGATCAACAACCCGGTTCACGCGCAACTGCCCATCAAGATCCGCT
JMFS124B03+ CCCCTTCTCCCCAGCGGATCAACAACCCGGTTCACGCGCAACTGCCCATCAAGATCCGCT
JMFS002G05+ CCCCTTCTCCCCAGCGGATCAACAACCCGGTTCACGCGCAACTGCCCATCAAGATCCGCT
JMFS036B09+ CCCCTTCTCCCCAGCGGATCAACAACCCGGTTCACGCGCAACTGCCCATCAAGATCCGCT
JMFS043D02+ CCCCTTCTCCCCAGCGGATCAACAACCCGGTTCACGCGCAACTGCCCATCAAGATCCGCT
JMFS018E01+ CCCCTTCTCCCCAGCGGATCAACAACCCGGTTCACGCGCAACTGCCCATCAAGATCCGCT
JMFS058E12+ CCCCTTCTCCCCAGCGGATCAACAACCCGGTTCACGCGCAACTGCCCATCAAGATCCGCT
JMFS003F02+ CCCCTTCTCCCCAGCGGATCAACAACCCGGTTCACGCGCAACTGCCCATCAAGATCCGCT
JMSF003H16+ CCCCTTCTCCCCAGCGGATCAACAACCCGGTTCACGCGCAACTGCCCATCAAGATCCGCT
JMFS065B12+ CCCCTTCTCCCCAGCGGATCAACAACCCGGTTCACGCGCAACTGCCCATCAAGATCCGCT
                      ____________________________________________________________
consensus CCCCTTCTCCCCAGCGGATCAACAACCCGGTTCACGCGCAACTGCCCATCAAGATCCGCT
 
. : . : . : . : . : . :
JMFS138D04+ ACAGACTTCGATGAGCTCAG
JMFS020F04+ ACAGACTTCGATGAGCTCAGAAATGAACTCAGTCTAGATATCTCCAGCCTTGAAACTCCC
JMFS066G03+ ACAGACTTCGATGAGCTCAGAAATGAACTCAGTCTAGATATCTCCAGCCTTGAAACTCCC
JMFS129F09+ ACAGACTTCGATGAGCTCAGAAATGAACTCAGTCTAGATATCTCCAGCCTTGAAACTCCC
JMFS141F06+ ACAGACTTCGATGAGCTCAGAAATGAACTCAGTCTAGATATCTCCAGCCTTGAAACTCCC
JMFS090H12+ ACAGACTTCGATGAGCTCAGAAATGAACTCAGTCTAGATATCTCCAGCCTTGAAACTCCC
JMFS059F07+ ACAGACTTCGATGAGCTCAGAAATGAACTCAGTCTAGATATCTCCAGCCTTGAAACTCCC
JMFS167G10+ ACAGACTTCGATGAGCTCAGAAATGAACTCAGTCTAGATATCTCCAGCCTTGAAACTCCC
JMFS132B04+ ACAGACTTCGATGAGCTCAGAAATGAACTCAGTCTAGATATCTCCAGCCTTGAAACTCCT
JMFS066D11+ ACAGACTTCGATGAGCTCAGAAATGAACTCAGTCTAGATATCTCCAGCCTTGAAACTCCC
JMFS024D08+ ACAGACTTCGATGAGCTCAGAAATGAACTCAGTCTAGATATCTCCAGCCTTGAAACTCCC
JMFS160C07+ ACAGACTTCGATGAGCTCAGAAATGAACTCAGTCTAGATATCTCCAGCCTTGAAACTCCC
JMFS011G11+ ACAGACTTCGATGAGCTCAGAAATGAACTCAGTCTAGATATCTCCAGCCTTGAAACTCCC
JMFS123H08+ ACAGACTTCGATGAGCTCAGAAATGAACTCAGTCTAGATATCTCCAGCCTTGAAACTCCC
JMFS115E01+ ACAGACTTCGATGAGCTCAGAAATGAACTCAGTCTAGATATCTCCAGCCTTGAAACTCCC
JMFS150B07+ ACAGACTTCGATGAGCTCAGAAATGAACTCAGTCTAGATATCTCCAGCCTTGAAACTCCC
JMFS053E03+ ACAGACTTCGATGAGCTCAGAAATGAACTCAGTCTAGATATCTCCAGCCT
JMFS013E08+ ACAGACTTCGATGAGCTCAGAAATGAACTCAGTCTAGATATCTCCAGCCTTGAAACTCCC
JMFS094E05+ ACAGACTTCGATGAGCTCAGAAATGAACTCAGTCTAGATATCTCCAGCCTTGAAACTCCC
JMFS124B03+ ACAGACTTCGATGAGCTCAGAAATGAACTCAGTCTAGATATCTCCAGCCTTGAAACTCCC
JMFS002G05+ ACAGACTTCGATGAGCTCAGAAATGAACTCAGTCTAGATATCTCCAGCCTTGAAACTCCC
JMFS036B09+ ACAGACTTCGATGAGCTCAGAAATGAACTCAGTCTAGATATCTCCAGCCTTGAAACTCCC
JMFS043D02+ ACAGACTTCGATGAGCTCAGAAATGAACTCAGTCTAGATATCTCCAGCCTTGAAACTCCC
JMFS018E01+ ACAGACTTCGATGAGCTCAGAAATGAACTCAGTCTAGATATCTCCAGCCTTGAAACTCCC
JMFS058E12+ ACAGACTTCGATGAGCTCAGAAATGAACTCAGTCTAGATATCTCCAGCCTTGAAACTCCC
JMFS003F02+ ACAGACTTCGATGAGCTCAGAAATGAACTCAGTCTAGATATCTCCAGCCTTGAAACTCCC
JMSF003H16+ ACAGACTTCGATGAGCTCAGAAATGAACTCAGTCTAGATATCTCCAGCCTTGAAACTCCC
JMFS065B12+ ACAGACTTCGATGAGCTCAGAAATGAACTCAGTCTAGATATCTCCAGCCTTGAAACTCCC
                      ____________________________________________________________
consensus ACAGACTTCGATGAGCTCAGAAATGAACTCAGTCTAGATATCTCCAGCCTTGAAACTCCC
 
. : . : . : . : . : . :
JMFS020F04+ AACAGCTCATTTACCAGA-GCCATTTTTAGCACTATCAAACACTCTACTCGATTGTTGTC
JMFS066G03+ AACAGCTCATTTACCAGA-GCCATTTTTAGCACTATCAAACACTCTACTCGATTGTTGTC
JMFS129F09+ AACAGCTCATTTACCAGA-GCCATTTTTAGCACTATCAAACACTCTACTCGATTGTTGTC
JMFS141F06+ AACAGCTCATTTACCAGA-GCCATTTTTAGCACTATCAAACACTCTACTCGATTGTTGTC
JMFS090H12+ AACAGCTCATTTACCAGA-GCCATTTTTAGCACTATCAAACACTCTACTCGATTGTTGTC
JMFS059F07+ AACAGCTCATTTACCAGA-GCCATTTTTAGCACTATCAAACACTCTACTCGATTGTTGTC
JMFS167G10+ AACAGCTCATTTACCAGA-GCCATTTTTAGCACTATCAAACACTCTACTCGATTGTTGTC
JMFS132B04+ AACAGCTCATTTACCAGA-GCCATTTTTAGCACTATCAAACACTCTACTCGATTGTTGTC
JMFS066D11+ AACAGCTCATTTACCAGA-GCCATTTTTAGCACTATCAAACACTCTACTCGATTGTTGTC
JMFS024D08+ AACAGCTCATTTACCAGA-GCCATTTTTAGCACTATCAAACACTCTACTCGATTGTTGTC
JMFS160C07+ AACAGCTCATTTACCAGA-GCCATTTTTAGCACTATCAAACACTCTACTCGATTGTTGTC
JMFS011G11+ AACAGCTCATTTACCAGA-GCCATTTTTAGCACTATCAAACACTCTACTCGATTGTTGTC
JMFS123H08+ AACAGCTCATTTACCAGA-GCCATTTTTAGCACTATCAAACACTCTACTCGATTGTTGTC
JMFS115E01+ AACAGCTCATTTACCAGA-GCCATTTTTAGCACTATCAAACACTCTACTCGATTGTTGTC
JMFS150B07+ AACAGCTCATTTACCAGA-GCCATTTTTAGCACTATCAAACACTCTACTCGATTGTTGTC
JMFS013E08+ AACAGCTCATTTACCAGA-GCCATTTTTAGCACTATCAAACACTCTACTCGATTGTTGTC
JMFS094E05+ AACAGCTCATTTACCAGA-GCCATTTTTAGCACTATCAAACACTCTACTCGATTGTTGTC
JMFS124B03+ AACAGCTCATTTACCAGA-GCCATTTTTAGCACTATCAAACACTCTACTCGATTGTTGTC
JMFS002G05+ AACAGCTCATTTACCAGA-GCCATTTTTAGCACTATCAAACACTCTACTCGATTGTTGTC
JMFS036B09+ AACAGCTCATT
JMFS043D02+ AACAGCTCATTTACCAGA-GCCATTTTTAGCACTATCAAACACTCTACTCGATTGTTGTC
JMFS018E01+ AACAGCTCATTTACCAGA-GCCATTTTTAGCACTATCAAACACTCTACTCGATTGTTGTC
JMFS058E12+ AACAGCTCATTTACCAGA-GCCATTTTTAGCACTATCAAACACTCTACTCGATTGTTGTC
JMFS003F02+ AACAGCTCATTTACCACACGCCATTTTTAGCACTATCAAACACTCTACTCGATTGTTGTC
JMSF003H16+ AACAGCTCATTTACCAGA-GCCATTTTTAGCACTATCAAACACTCTACTCGATTGTTGTC
JMFS065B12+ AACAGCTCATTTACCAGA-GCCATTTTTAGCACTATCAAACACTCTACTCGATTGTTGTC
                      ____________________________________________________________
consensus AACAGCTCATTTACCAGA-GCCATTTTTAGCACTATCAAACACTCTACTCGATTGTTGTC
 
. : . : . : . : . : . :
JMFS020F04+ AGCTCTCTGCTCTTTTAGATTAT
JMFS066G03+ AGCTCTCTGCTCTTTTAGATTATTTTTGAGAAAGAAAGAAAGAGAGAAGAGAGAGAGAGA
JMFS129F09+ AGCTCTCTGCTCTTTTAGATTATTTTTGAGAAAGAAAGAAAGAGAGAAGAGAGAGAGAGA
JMFS141F06+ AGCTCTCTGCTCTTTTAGATTATTTTTGAGAAAGAAAGAAAGAGAGAAGAGAGAGAGAGA
JMFS090H12+ AGCTCTCTGCTCTTTTAGATTATTTTTGAGAAAGAAAGAAAGAGAGAAGA
JMFS059F07+ AGCTCTCTGCTCTTTTAGATTATTTTTGAGAAAGAAAGAAAGAGAGAAGAGAGAGAGAGA
JMFS167G10+ AGCTCTCTGCTCTTTTAGATTATTTTTGAGAAAGAAAGAAAGAGAGAAGAGAGAGAGAGA
JMFS132B04+ AGCTCTCTGCTCTTTTAGATTATTTTTGAGAAAGAAAGAAAGAGAGAAGAGAGAGAGAGA
JMFS066D11+ AGCTCTCTGCTCTTTTAGATTATTTTTGAGAAAGAAAGAAAGAGAGAAGAGAGAGAGAGA
JMFS024D08+ AGCTCTCTGCTCTTTTAGATTATTTTTGAGAAAGAAAGAAAGAGAGAAGAGAGAGAGAGA
JMFS160C07+ AGCTCTCTGCTCTTTTAGATTATTTTTGAGAAAGAAAGAAAGAGAGAAGAGAGAGAGAGA
JMFS011G11+ AGCTCTCTGCTCTTTTAGATTATTTTTGAGAAAGAAAGAAAGAGAGAAGAGAGAGAGAGA
JMFS123H08+ AGCTCTCTGCTCTTTTAGATTATTTTTGAGAAA
JMFS115E01+ AGCTCTCTGCTCTTTTAGATTATTTTTGAGAAAGAAAGAAAGAGAGAAGAGAGAGAGAGA
JMFS150B07+ AGCTCTCTGCTCTTTTAGATTATTTTTGAGAAAGAAAGAAAGAGAGAAGAGAGAGAGAGA
JMFS013E08+ AGCTCTCTGCTCTTTTAGATTATTTTTGAGAAAGAAAGAAAGAGAGAAGAGAGAGAGAGA
JMFS094E05+ AGCTCTCTGCTCTTTTAGATTATTTTTGAGAAAGAAAGAAAGAGAGAAGAGAGAGAGAGA
JMFS124B03+ AGCTCTCTGCTCTTTTAGATTATTTTTGAGAAAGAAAGAAAGAGAGAAGAGAGAGAGAGA
JMFS002G05+ AGCTCTCTGCTCTTTTAGATTATTTTTGAGAAAGAAAGAAAGAGAGAAGAGAGAGAGAGA
JMFS043D02+ AGCTCTCTGCTCTTTTAGATTATTTTTGAGAAAGAAAGAAAGAGAGAAGAGAGAGAGAGA
JMFS018E01+ AGCTCTCTGCTCTTTTAGATTATTTTTGAGAAAGAAAGAAAGAGAGAAGAGAGAGAGAGA
JMFS058E12+ AGCTCTCTGCTCTTTTAGATTATTTTTGAGAAAGAAAGAAAGAGAGAAGAGAGAGAGAGA
JMFS003F02+ AGCTCTCTGCTCTTTTAGATTATTTTTGAGAAAGAAAGAAAGAGAGAAGAGAGAGAGAGA
JMSF003H16+ AGCTCTCTGCTCTTTTAGATTATTTTTGAGAAAGAAAGAAAGAGAGAAGAGAGAGAGAGA
JMFS065B12+ AGCTCTCTGCTCTTTTAGATTATTTTTGAGAAAGAAAGAAAGAGAGAAGAGAGAGAGAGA
                      ____________________________________________________________
consensus AGCTCTCTGCTCTTTTAGATTATTTTTGAGAAAGAAAGAAAGAGAGAAGAGAGAGAGAGA
 
. : . : . : . : . : . :
JMFS066G03+ AAAGA
JMFS129F09+ AAAGA
JMFS141F06+ AAAGA
JMFS059F07+ AAAGAG
JMFS167G10+ AAAGAGTGA
JMFS132B04+ AAAGAGTG
JMFS066D11+ AAAGAGTGA
JMFS024D08+ AAAGAGTGAA
JMFS160C07+ AAAGAGTGAA
JMFS011G11+ AAAG
JMFS115E01+ AAAGAGT
JMFS150B07+ AAAGA
JMFS013E08+ AAAGAGTGAA
JMFS094E05+ AAAGAGTGAA
JMFS124B03+ AAAGAGTGAATTATA
JMFS002G05+ AAAGAGTGAA
JMFS043D02+ AAAGAGTGAATTATA
JMFS018E01+ AAAGAGTGAATTATAGAGGGT
JMFS058E12+ AAAGAGTGAATTATAGAGGGTGTTTTG
JMFS003F02+ AAAGAGTGAATTATAGAGGGTGTTTTG
JMSF003H16+ AAAGAGTGAATTATAGAGGGTGTTTTGGTTAGTATA
JMFS065B12+ AAAGAGTGAATTATAGAGGGTGTTTTGGTTAGTATAATAACAGAGACAGAGTCTGATACA
                      ____________________________________________________________
consensus AAAGAGTGAATTATAGAGGGTGTTTTGGTTAGTATAATAACAGAGACAGAGTCTGATACA