Previous Contig 003392:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS007G07Sequence636003392 (45)gb:AB025604_15162531e-04Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F2O15.>gb:BT004606_163
JMFS010H04Sequence631003392 (45)gb:OSJN00253_16974361e-16Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0072D08, complete seque
JMFS012C11Sequence608003392 (45)gb:OSJN00253_16974366e-11Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0072D08, complete seque
JMFS018B10Sequence612003392 (45)gb:OSJN00253_16974363e-17Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0072D08, complete seque
JMFS021B02Sequence623003392 (45)gb:AB025604_15162531e-04Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F2O15.>gb:BT004606_163
JMFS023H03Sequence395003392 (45)
JMFS030H04Sequence614003392 (45)gb:OSJN00253_16974363e-17Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0072D08, complete seque
JMFS032F09Sequence554003392 (45)gb:AP003875_18346715e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11
JMFS042D09Sequence626003392 (45)gb:AB025604_15162531e-04Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F2O15.>gb:BT004606_163
JMFS044F07Sequence625003392 (45)gb:AB025604_15162531e-04Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F2O15.>gb:BT004606_163
JMFS049G12Sequence601003392 (45)gb:AB025604_15162531e-04Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F2O15.>gb:BT004606_163
JMFS060B01Sequence627003392 (45)gb:AB025604_15162535e-05Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F2O15.>gb:BT004606_163
JMFS062C05Sequence624003392 (45)gb:AB025604_15162531e-04Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F2O15.>gb:BT004606_163
JMFS064F09Sequence620003392 (45)gb:AB025604_15162531e-04Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F2O15.>gb:BT004606_163
JMFS067H03Sequence617003392 (45)gb:AB025604_15162531e-04Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F2O15.>gb:BT004606_163
JMFS069D03Sequence626003392 (45)gb:OSJN00253_16974364e-12Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0072D08, complete seque
JMFS074F11Sequence617003392 (45)gb:AB025604_15162531e-04Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F2O15.>gb:BT004606_163
JMFS079E05Sequence626003392 (45)gb:OSJN00253_16974362e-12Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0072D08, complete seque
JMFS081F04Sequence611003392 (45)gb:AP003875_18346716e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11
JMFS087H08Sequence620003392 (45)gb:AB025604_15162531e-04Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F2O15.>gb:BT004606_163
JMFS089A10Sequence624003392 (45)gb:AB025604_15162531e-04Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F2O15.>gb:BT004606_163
JMFS090D01Sequence607003392 (45)gb:AP003875_18346716e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11
JMFS091D09Sequence625003392 (45)gb:AP003875_18346716e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11
JMFS093G04Sequence621003392 (45)gb:AP003875_18346711e-14Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11
JMFS098H07Sequence626003392 (45)gb:AB025604_15162531e-04Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F2O15.>gb:BT004606_163
JMFS099A06Sequence623003392 (45)gb:AB025604_15162531e-04Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F2O15.>gb:BT004606_163
JMFS101F10Sequence618003392 (45)gb:AP003875_18346712e-12Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11
JMFS102A01Sequence624003392 (45)gb:AB025604_15162531e-04Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F2O15.>gb:BT004606_163
JMFS105A09Sequence619003392 (45)gb:AB025604_15162531e-04Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F2O15.>gb:BT004606_163
JMFS106E03Sequence616003392 (45)gb:AP003875_18346716e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11
JMFS114A07Sequence552003392 (45)gb:AB025604_15162539e-05Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F2O15.>gb:BT004606_163
JMFS121C04Sequence581003392 (45)gb:AP003875_18346712e-12Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11
JMFS124G06Sequence572003392 (45)gb:AB025604_15162531e-04Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F2O15.>gb:BT004606_163
JMFS128H09Sequence622003392 (45)gb:AB025604_15162531e-04Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F2O15.>gb:BT004606_163
JMFS130A01Sequence626003392 (45)gb:AP003875_18346716e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11
JMFS131D09Sequence619003392 (45)gb:AB025604_15162531e-04Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F2O15.>gb:BT004606_163
JMFS131E04Sequence605003392 (45)gb:AB025604_15162531e-04Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F2O15.>gb:BT004606_163
JMFS131H06Sequence626003392 (45)gb:OSJN00253_16974363e-16Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0072D08, complete seque
JMFS135C10Sequence620003392 (45)gb:AP003875_18346712e-12Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ11
JMFS140E06Sequence624003392 (45)gb:AB025604_15162531e-04Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F2O15.>gb:BT004606_163
JMFS145D10Sequence626003392 (45)gb:AB025604_15162531e-04Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F2O15.>gb:BT004606_163
JMFS145F03Sequence636003392 (45)gb:AB025604_15162531e-04Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F2O15.>gb:BT004606_163
JMFS147F10Sequence615003392 (45)gb:AB025604_15162531e-04Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F2O15.>gb:BT004606_163
JMFS149E01Sequence612003392 (45)gb:AB025604_15162531e-04Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F2O15.>gb:BT004606_163
JMFS150B09Sequence561003392 (45)gb:AB025604_15162538e-04Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F2O15.>gb:BT004606_163

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS093G04+ ATGTTATGAGGTTTGTCATTGAATGCCGACCCTGGTTCCCTT
                      ____________________________________________________________
consensus ATGTTATGAGGTTTGTCATTGAATGCCGACCCTGGTTCCCTT
 
. : . : . : . : . : . :
JMFS093G04+ TTCGTGGGCTTCATGATGCACTTGGCAATATCACCGGTTTCTAAATAGCGCTGAGCATCT
                      ____________________________________________________________
consensus TTCGTGGGCTTCATGATGCACTTGGCAATATCACCGGTTTCTAAATAGCGCTGAGCATCT
 
. : . : . : . : . : . :
JMFS093G04+ TTTTTGGAACGGAATCCAAATCCACTAACAGGGTCTACATAAAACGGGTCGCTTTTTGTC
JMFS135C10+ TTTTTGGAACGGAATCCAAATCCACTAACAGGGTCTACATAAAACGGGTCGCTTTTTGTC
JMFS101F10+ AAACGGGTCGCTTTTTGTC
                      ____________________________________________________________
consensus TTTTTGGAACGGAATCCAAATCCACTAACAGGGTCTACATAAAACGGGTCGCTTTTTGTC
 
. : . : . : . : . : . :
JMFS093G04+ CCACATTTTCTAGCTCTAAATTCTCTAGTCCACCCTGGTGGCAGCCCATCAACAGACTCG
JMFS135C10+ CCACATTTTCTAGCTCTAAATTCTCTAGTCCACCCTGGTGGCAGCCCATCAACAGACTCG
JMFS101F10+ CCACATTTTCTAGCTCTAAATTCTCTAGTCCACCCTGGTGGCAGCCCATCAACAGACTCG
JMFS121C04+ CAGCCCATCAACAGACTCG
                      ____________________________________________________________
consensus CCACATTTTCTAGCTCTAAATTCTCTAGTCCACCCTGGTGGCAGCCCATCAACAGACTCG
 
. : . : . : . : . : . :
JMFS093G04+ GTTTGACCTTCAGCATTAGAAACAACTTTTGCAGGGCGCTTGCCACTGCCAGATTTCTGC
JMFS135C10+ GTTTGACCTTCAGCATTAGAAACAACTTTTGCAGGGCGCTTGCCACTGCCAGATTTCTGC
JMFS101F10+ GTTTGACCTTCAGCATTAGAAACAACTTTTGCAGGGCGCTTGCCACTGCCAGATTTCTGC
JMFS121C04+ GTTTGACCTTCAGCATTAGAAACAACTTTTGCAGGGCGCTTGCCACTGCCAGATTTCTGC
                      ____________________________________________________________
consensus GTTTGACCTTCAGCATTAGAAACAACTTTTGCAGGGCGCTTGCCACTGCCAGATTTCTGC
 
. : . : . : . : . : . :
JMFS093G04+ TTTTTGGCTACGTGGCGTTTGACCTTCATTGGTTTTTTATTTTTAGACACTTTCAGCTTA
JMFS135C10+ TTTTTGGCTACGTGGCGTTTGACCTTCATTGGTTTTTTATTTTTAGACACTTTCAGCTTA
JMFS101F10+ TTTTTGGCTACGTGGCGTTTGACCTTCATTGGTTTTTTATTTTTAGACACTTTCAGCTTA
JMFS121C04+ TTTTTGGCTACGTGGCGTTTGACCTTCATTGGTTTTTTATTTTTAGACACTTTCAGCTTA
                      ____________________________________________________________
consensus TTTTTGGCTACGTGGCGTTTGACCTTCATTGGTTTTTTATTTTTAGACACTTTCAGCTTA
 
. : . : . : . : . : . :
JMFS093G04+ GGAGAGGGCTTTCCAGTGTCATAAGATAAGTCAGTGGAAGTTGGTCCCGGTTCCCTTAGG
JMFS135C10+ GGAGAGGGCTTTCCAGTGTCATAAGATAAGTCAGTGGAAGTTGGTCCCGGTTCCCTTAGG
JMFS101F10+ GGAGAGGGCTTTCCAGTGTCATAAGATAAGTCAGTGGAAGTTGGTCCCGGTTCCCTTAGG
JMFS121C04+ GGAGAGGGCTTTCCAGTGTCATAAGATAAGTCAGTGGAAGTTGGTCCCGGTTCCCTTAGG
JMFS090D01+ CTTAGG
                      ____________________________________________________________
consensus GGAGAGGGCTTTCCAGTGTCATAAGATAAGTCAGTGGAAGTTGGTCCCGGTTCCCTTAGG
 
. : . : . : . : . : . :
JMFS093G04+ GTAGGCTTCATAGCACACTTGCTAATATCACCAGTTTCTATATAGCGAAAAGCATCTTTT
JMFS135C10+ GTAGGCTTCATAGCACACTTGCTAATATCACCAGTTTCTATATAGCGAAAAGCATCTTTT
JMFS101F10+ GTAGGCTTCATAGCACACTTGCTAATATCACCAGTTTCTATATAGCGAAAAGCATCTTTT
JMFS121C04+ GTAGGCTTCATAGCACACTTGCTAATATCACCAGTTTCTATATAGCGAAAAGCATCTTTT
JMFS090D01+ GTAGGCTTCATAGCACACTTGCTAATATCACCAGTTTCTATATAGCGAAAAGCATCTTTT
                      ____________________________________________________________
consensus GTAGGCTTCATAGCACACTTGCTAATATCACCAGTTTCTATATAGCGAAAAGCATCTTTT
 
. : . : . : . : . : . :
JMFS093G04+ TTGGATCTGAATACATATCCACTGACAGGATCTGTATAATACGGGTCCTTTCTTATCCCA
JMFS135C10+ TTGGATCTGAATACATATCCACTGACAGGATCTGTATAATACGGGTCCTTTCTTATCCCA
JMFS101F10+ TTGGATCTGAATACATATCCACTGACAGGATCTGTATAATACGGGTCCTTTCTTATCCCA
JMFS121C04+ TTGGATCTGAATACATATCCACTGACAGGATCTGTATAATACGGGTCCTTTCTTATCCCA
JMFS090D01+ TTGGATCTGAATACATATCCACTGACAGGATCTGTATAATACGGGTCCTTTCTTATCCCA
JMFS130A01+ TCCCA
                      ____________________________________________________________
consensus TTGGATCTGAATACATATCCACTGACAGGATCTGTATAATACGGGTCCTTTCTTATCCCA
 
. : . : . : . : . : . :
JMFS093G04+ TGCCCAAGTCTTCTAGTTTTGTATTCTTTTATCCACCCTGCTGGTAACTCACTCTCTGAA
JMFS135C10+ TGCCCAAGTCTTCTAGTTTTGTATTCTTTTATCCACCCTGCTGGTAACTCACTCTCTGAA
JMFS101F10+ TGCCCAAGTCTTCTAGTTTTGTATTCTTTTATCCACCCTGCTGGTAACTCACTCTCTGAA
JMFS121C04+ TGCCCAAGTCTTCTAGTTTTGTATTCTTTTATCCACCCTGCTGGTAACTCACTCTCTGAA
JMFS090D01+ TGCCCAAGTCTTCTAGTTTTGTATTCTTTTATCCACCCTGCTGGTAACTCACTCTCTGAA
JMFS130A01+ TGCCCAAGTCTTCTAGTTTTGTATTCTTTTATCCACCCTGCTGGTAACTCACTCTCTGAA
                      ____________________________________________________________
consensus TGCCCAAGTCTTCTAGTTTTGTATTCTTTTATCCACCCTGCTGGTAACTCACTCTCTGAA
 
. : . : . : . : . : . :
JMFS093G04+ CCATTTTGAACTGCAACAGGAGAAACTATCTTTGCAGGA
JMFS135C10+ CCATTTTGAACTGCAACAGGAGAAACTATCTTTGCAGGACGCTTGTCCACAACAGATTTA
JMFS101F10+ CCATTTTGAACTGCAACAGGAGAAACTATCTTTGCAGGACGCTTGTCCACAACAGATTTA
JMFS121C04+ CCATTTTGAACTGCAACAGGAGAAACTATCTTTGCAGGACGCTTGTCCACAACAGATTTA
JMFS090D01+ CCATTTTGAACTGCAACAGGAGAAACTATCTTTGCAGGACGCTTGTCCACAACAGATTTA
JMFS130A01+ CCATTTTGAACTGCAACAGGAGAAACTATCTTTGCAGGACGCTTGTCCACAACAGATTTA
JMFS032F09+ AGGAGAAACTATCTTTGCAGGACGCTTGTCCACAACAGATTTA
JMFS081F04+ ACTGCAACAGGAGAAACTATCTTTGCAGGACGCTTGTCCACAACAGATTTA
JMFS106E03+ GACGCTTGTCCACAACAGATTTA
JMFS091D09+ GCAGGACGCTTGTCCACAACAGATTTA
                      ____________________________________________________________
consensus CCATTTTGAACTGCAACAGGAGAAACTATCTTTGCAGGACGCTTGTCCACAACAGATTTA
 
. : . : . : . : . : . :
JMFS135C10+ CGTCTTTTGGATATCTGACTGTTGTCCTCCACAGATTTTTCATTTGGAGACACTTCTTCT
JMFS101F10+ CGTCTTTTGGATATCTGACTGTTGTCCTCCACAGATTTTTCATTTGGAGACACTTCTTCT
JMFS121C04+ CGTCTTTTGGATATCTGACTGTTGTCCTCCACAGATTTTTCATTTGGAGACACTTCTTCT
JMFS090D01+ CGTCTTTTGGATATCTGACTGTTGTCCTCCACAGATTTTTCATTTGGAGACACTTCTTCT
JMFS130A01+ CGTCTTTTGGATATCTGACTGTTGTCCTCCACAGATTTTTCATTTGGAGACACTTCTTCT
JMFS032F09+ CGTCTTTTGGATATCTGACTGTTGTCCTCCACAGATTTTTCATTTGGAGACACTTCTTCT
JMFS081F04+ CGTCTTTTGGATATCTGACTGTTGTCCTCCACAGATTTTTCATTTGGAGACACTTCTTCT
JMFS106E03+ CGTCTTTTGGATATCTGACTGTTGTCCTCCACAGATTTTTCATTTGGAGACACTTCTTCT
JMFS091D09+ CGTCTTTTGGATATCTGACTGTTGTCCTCCACAGATTTTTCATTTGGAGACACTTCTTCT
JMFS018B10+ CTGACTGTTGTCCTCCACAGATTTTTCATTTGGAGACACTTCTTCT
JMFS030H04+ TCCACAGATTTTTCATTTGGAGACACTTCTTCT
                      ____________________________________________________________
consensus CGTCTTTTGGATATCTGACTGTTGTCCTCCACAGATTTTTCATTTGGAGACACTTCTTCT
 
. : . : . : . : . : . :
JMFS135C10+ ATGTTATGATGTATGTCCTT
JMFS101F10+ ATGTTATGATGTATGTCCTTGGATGCTGATTCGTCCCTTTTCTTGGGCTTTATCACACA
JMFS121C04+ ATGTTATGATGTATGTCCTTGGATGCTGATTCGTCCCTTTTCTTGGGCTTTATCACACAC
JMFS090D01+ ATGTTATGATGTATGTCCTTGGATGCTGATTCGTCCCTTTTCTTGGGCTTTATCACACAC
JMFS130A01+ ATGTTATGATGTATGTCCTTGGATGCTGATTCGTCCCTTTTCTTGGGCTTTATCACACAC
JMFS032F09+ ATGTTATGATGTATGTCCTTGGATGCTGATTCGTCCCTTTTCTTGGGCTTTATCACACAC
JMFS081F04+ ATGTTATGATGTATGTCCTTGGATGCTGATTCGTCCCTTTTCTTGGGCTTTATCACACAC
JMFS106E03+ ATGTTATGATGTATGTCCTTGGATGCTGATTCGTCCCTTTTCTTGGGCTTTATCACACAC
JMFS091D09+ ATGTTATGATGTATGTCCATGGATGCTGATTCGTCCCTTTTCTTGGGCTTTATCACACAC
JMFS018B10+ ATGTTATGATGTATGTCCTTGGATGCTGATTCGTCCCTTTTCTTGGGCTTTATCACACAC
JMFS030H04+ ATGTTATGATGTATGTCCTTGGATGCTGATTCGTCCCTTTTCTTGGGCTTTATCACACAC
JMFS010H04+ C
                      ____________________________________________________________
consensus ATGTTATGATGTATGTCCTTGGATGCTGATTCGTCCCTTTTCTTGGGCTTTATCACACAC
 
. : . : . : . : . : . :
JMFS121C04+ TTTTTAATATCACCAGTTTCTA
JMFS090D01+ TTTTTAATATCACCAGTTTCTAAATAGCGCATAACATCTCTTTTGGAGCGGAACTCATAT
JMFS130A01+ TTTTTAATATCACCAGTTTCTAAATAGCGCATAACATCTCTTTTGGAGCGGAACTCATAT
JMFS032F09+ TTTTTAATATCACCAGTTTCTAAATAGCGCATAACATCTCTTTTGGAGCGGAACTCATAT
JMFS081F04+ TTTTTAATATCACCAGTTTCTAAATAGCGCATAACATCTCTTTTGGAGCGGAACTCATAT
JMFS106E03+ TTTTTAATATCACCAGTTTCTAAATAGCGCATAACATCTCTTTTGGAGCGGAACTCATAT
JMFS091D09+ TTTTTAATATCACCAGTTTCTAAATAGCGCATAACATCTCTTTTGGAGCGGAACTCATAT
JMFS018B10+ TTTTTAATATCACCAGTTTCTAAATAGCGCATAACATCTCTTTTGGAGCGGAACTCATAT
JMFS030H04+ TTTTTAATATCACCAGTTTCTAAATAGCGCATAACATCTCTTTTGGAGCGGAACTCATAT
JMFS131H06+ TTTTAATATCACCAGTTTCTAAATAGCGCATAACATCTCTTTTGGAGCGGAACTCATAT
JMFS010H04+ TTTTTAATATCACCAGTTTCTAAATAGCGCATAACATCTCTTTTGGAGCGGAACTCATAT
JMFS069D03+ CATAACATCTC-TTTGGAGCGGAACTCATAT
JMFS079E05+ TAACATCTCTTTTGGAGCGGAACTCATAT
                      ____________________________________________________________
consensus TTTTTAATATCACCAGTTTCTAAATAGCGCATAACATCTCTTTTGGAGCGGAACTCATAT
 
. : . : . : . : . : . :
JMFS090D01+ CCGCTGACAGGGTCTATATAATACGGATCCTTTCTTATCCCACTCGGGCATGTCCTTGTT
JMFS130A01+ CCGCTGACAGGGTCTATATAATACGGATCCTTTCTTATCCCACTCGGGCATGTCCTTGTT
JMFS032F09+ CCGCTGACAGGGTCTATATAATACGGATCCTTTCTTATCCCACTCGGGCATGTCCTTGTT
JMFS081F04+ CCGCTGACAGGGTCTATATAATACGGATCCTTTCTTATCCCACTCGGGCATGTCCTTGTT
JMFS106E03+ CCGCTGACAGGGTCTATATAATACGGATCCTTTCTTATCCCACTCGGGCATGTCCTTGTT
JMFS091D09+ CCGCTGACAGGGTCTATATAATACGGATCCTTTCTTATCCCACTCGGGCATGTCCTTGTT
JMFS018B10+ CCGCTGACAGGGTCTATATAATACGGATCCTTTCTTATCCCACTCGGGCATGTCCTTGTT
JMFS030H04+ CCGCTGACAGGGTCTATATAATACGGATCCTTTCTTATCCCACTCGGGCATGTCCTTGTT
JMFS131H06+ CCGCTGACAGGGTCTATATAATACGGATCCTTTCTTATCCCACTCGGGCATGTCCTTGTT
JMFS010H04+ CCGCTGACAGGGTCTATATAATACGGATCCTTTCTTATCCCACTCGGGCATGTCCTTGTT
JMFS069D03+ CCGCTGACAGGGTCTATATAATACGGATCCTTTCTTATCCCACTCGGGCATGTCCTTGTT
JMFS079E05+ CCGCTGACAGGGTCTATATAATACGGATCCTTTCTTATCCCACTCGGGCATGTCCTTGTT
JMFS012C11+ CCGCTGACAGGGTCTATATAATACGGATCCTTTCTTATCCCACTCGGGCATGTCCTTGTT
JMFS149E01+ TCCCACTCGGGCATGTCCTTGTT
                      ____________________________________________________________
consensus CCGCTGACAGGGTCTATATAATACGGATCCTTTCTTATCCCACTCGGGCATGTCCTTGTT
 
. : . : . : . : . : . :
JMFS090D01+ CTTAATTCTTTTACCCACCCTGCTGGTAACCCATCTGCTGAAATGTCTTGTGCTGCAACT
JMFS130A01+ CTTAATTCTTTTACCCACCCTGCTGGTAACCCATCTGCTGAAATGTCTTGTGCTGCAACT
JMFS032F09+ CTTAATTCTTTTACCCACCCTGCTGGTAACCCATCTGCTGAAATGTCTTGTGCTGCAACT
JMFS081F04+ CTTAATTCTTTTACCCACCCTGCTGGTAACCCATCTGCTGAAATGTCTTGTGCTGCAACT
JMFS106E03+ CTTAATTCTTTTACCCACCCTGCTGGTAACCCATCTGCTGAAATGTCTTGTGCTGCAACT
JMFS091D09+ CTTAATTCTTTTACCCACCCTGCTGGTAACCCATCTGCTGAAATGTCTTGTGCTGCAACT
JMFS018B10+ CTTAATTCTTTTACCCACCCTGCTGGTAACCCATCTGCTGAAATGTCTTGTGCTGCAACT
JMFS030H04+ CTTAATTCTTTTACCCACCCTGCTGGTAACCCATCTGCTGAAATGTCTTGTGCTGCAACT
JMFS131H06+ CTTAATTCTTTTACCCACCCTGCTGGTAACCCATCTGCTGAAATGTCTTGTGCTGCAACT
JMFS010H04+ CTTAATTCTTTTACCCACCCTGCTGGTAACCCATCTGCTGAAATGTCTTGTGCTGCAACT
JMFS069D03+ CTTAATTCTTTTACCCACCCTGCTGGTAACCCATCTGCTGAAATGTCTTGTGCTGCAACT
JMFS079E05+ CTTAATTCTTTTACCCACCCTGCTGGTAACCCATCTGCTGAAATGTCTTGTGCTGCAACT
JMFS012C11+ CTTAATTCTTTTACCCACCCTGCTGGTAACCCATCTGCTGAAATGTCTTGTGCTGCAACT
JMFS124G06+ TTTTACCCACCCTGCTGGTAACCCATCTGCTGAAATGTCTTGTGCTGCAACT
JMFS149E01+ CTTAATTCTTTTACCCACCCTGCTGGTAACCCATCTGCTGAAATGTCTTGTGCTGCAACT
                      ____________________________________________________________
consensus CTTAATTCTTTTACCCACCCTGCTGGTAACCCATCTGCTGAAATGTCTTGTGCTGCAACT
 
. : . : . : . : . : . :
JMFS090D01+ GCAGGGGAAACTGTCTTAGGAGTCTGGTTGTCCATTACAGATTTCCGTTTTCGAGATGTA
JMFS130A01+ GCAGGGGAAACTGTCTTAGGAGTCTGGTTGTCCATTACAGATTTCCGTTTTCGAGATGTA
JMFS032F09+ GCAGGGGAAACTGTCTTAGGAGTCTGGTTGTCCATTACAGATTTCCGTTTTCGAGATGTA
JMFS081F04+ GCAGGGGAAACTGTCTTAGGAGTCTGGTTGTCCATTACAGATTTCCGTTTTCGAGATGTA
JMFS106E03+ GCAGGGGAAACTGTCTTAGGAGTCTGGTTGTCCATTACAGATTTCCGTTTTCGAGATGTA
JMFS091D09+ GCAGGGGAAACTGTCTTAGGAGTCTGGTTGTCCATTACAGATTTCCGTTTTCGAGATGTA
JMFS018B10+ GCAGGGGAAACTGTCTTAGGAGTCTGGTTGTCCATTACAGATTTCCGTTTTCGAGATGTA
JMFS030H04+ GCAGGGGAAACTGTCTTAGGAGTCTGGTTGTCCATTACAGATTTCCGTTTTCGAGATGTA
JMFS131H06+ GCAGGGGAAACTGTCTTAGGAGTCTGGTTGTCCATTACAGATTTCCGTTTTCGAGATGTA
JMFS010H04+ GCAGGGGAAACTGTCTTAGGAGTCTGGTTGTCCATTACAGATTTCCGTTTTCGAGATGTA
JMFS069D03+ GCAGGGGAAACTGTCTTAGGAGTCTGGTTGTCCATTACAGATTTCCGTTTTCGAGATGTA
JMFS079E05+ GCAGGGGAAACTGTCTTAGGAGTCTGGTTGTCCATTACAGATTTCCGTTTTCGAGATGTA
JMFS012C11+ GCAGGGGAAACTGTCTTAGGAGTCTGGTTGTCCATTACAGATTTCCGTTTTCGAGATGTA
JMFS124G06+ GCAGGGGAAACTGTCTTAGGAGTCTGGTTGTCCATTACAGATTTCCGTTTTCGAGATGTA
JMFS149E01+ GCAGGGGAAACTGTCTTAGGAGTCTGGTTGTCCATTACAGATTTCCGTTTTCGAGATGTA
JMFS147F10+ GAGATGTA
JMFS105A09+ TGTA
                      ____________________________________________________________
consensus GCAGGGGAAACTGTCTTAGGAGTCTGGTTGTCCATTACAGATTTCCGTTTTCGAGATGTA
 
. : . : . : . : . : . :
JMFS090D01+ C
JMFS130A01+ CGGCTCTGGTTCTCCTTAGGAGTTTGATTTTGAGGCACTTCCAGATTAGAGGAGGATTCT
JMFS032F09+ CGGCTCTGGTTCTCCTTAGGAGTTTGATTTTGAGGCACTTCCAGATTAGAGGAGGATTCT
JMFS081F04+ CGGCTCTGGTTCTCCTTAGGAGTTTGATTTTGAGGCACTTCCAGATTAGAGGAGGATTCT
JMFS106E03+ CGGCTCTGGTTCTCCTTAGGAGTTTGATTTTGAGGCACTTCCAGATTAGAGGAGGATTCT
JMFS091D09+ CGGCTCTGGTTCTCCTTAGGAGTTTGATTTTGAGGCACTTCCAGATTAGAGGAGGATTCT
JMFS018B10+ CGGCTCTGGTTCTCCTTAGGAGTTTGATTTTGAGGCACTTCCAGATTAGAGGAGGATTCT
JMFS030H04+ CGGCTCTGGTTCTCCTTAGGAGTTTGATTTTGAGGCACTTCCAGATTAGAGGAGGATTCT
JMFS131H06+ CGGCTCTGGTTCTCCTTAGGAGTTTGATTTTGAGGCACTTCCAGATTAGAGGAGGATTCT
JMFS010H04+ CGGCTCTGGTTCTCCTTAGGAGTTTGATTTTGAGGCACTTCCAGATTAGAGGAGGATTCT
JMFS069D03+ CGGCTCTGGTTCTCCTTAGGAGTTTGATTTTGAGGCACTTCCAGATTAGAGGAGGATTCT
JMFS079E05+ CGGCTCTGGTTCTCCTTAGGAGTTTGATTTTGAGGCACTTCCAGATTAGAGGAGGATTCT
JMFS012C11+ CGGCTCTGGTTCTCCTTAGGAGTTTGATTTTGAGGCACTTCCAGATTAGAGGAGGATTCT
JMFS124G06+ CGGCTCTGGTTCTCCTTAGGAGTTTGATTTTGAGGCACTTCCAGATTAGAGGAGGATTCT
JMFS149E01+ CGGCTCTGGTTCTCCTTAGGAGTTTGATTTTGAGGCACTTCCAGATTAGAGGAGGATTCT
JMFS147F10+ CGGCTCTGGTTCTCCTTAGGAGTTTGATTNTGAGGCACTTCCAGATTAGAGGAGGATTCT
JMFS105A09+ CGGCTCTGGTTCTCCTTAGGAGTTTGATTNTGAGGCACTTCCAGATTAGAGGAGGATTCT
JMFS145D10+ GGCTCTGGTTCTCCTTAGGAGTTTGATTNTGAGGCACTTCCAGATTAGAGGAGGATTCT
JMFS089A10+ GTTCTCCTTAGGAGTTTGATTNTGAGGCACTTCCAGATTAGAGGAGGATTCT
JMFS074F11+ GAGGCACTTCCAGATTAGAGGAGGATTCT
JMFS131E04+ GAGGCACTTCCAGATTAGAGGAGGATTCT
JMFS099A06+ TTTGAGGCACTTCCAGATTAGAGGAGGATTCT
JMFS145F03+ TAGGAGTTTGATTNTGAGGCACTTCCAGATTAGAGGAGGATTCT
JMFS007G07+ TAGGAGTTTGATTNTGAGGCACTTCCAGATTAGAGNAGGATTCT
JMFS128H09+ GAGGCACTTCCAGATTAGAGAAGGATTCT
JMFS140E06+ GGCACTTCCAGATTAGAGGAGGATTCT
JMFS087H08+ CTTCCAGATTAGAGGAGGATTCT
JMFS131D09+ TTCCAGATTAGAGGAGGATTCT
JMFS062C05+ GGCACTTCCAGATTAGAGGAGGATTCT
JMFS098H07+ GAGGCACTTCCAGATTAGAGGAGGATTCT
JMFS060B01+ GAGGCACTTCCAGATTAGAGGAGGATTCT
JMFS102A01+ GGCACTTCCAGATTAGAGGAGGATTCT
JMFS044F07+ GAGGCACTTCCAGATTAGAGGAGGATTCT
JMFS042D09+ GAGGCACTTCCAGATTAGAGNAGGATTCT
JMFS049G12+ GCACTTCCAGATTAGAGGAGGATTCT
JMFS021B02+ GGCACTTCCAGATTAGAGGAGGATTCT
JMFS067H03+ CAGATTAGAGGAGGATTCT
JMFS064F09+ TTCCAGATTAGAGNAGGATTCT
                      ____________________________________________________________
consensus CGGCTCTGGTTCTCCTTAGGAGTTTGATTTTGAGGCACTTCCAGATTAGAGGAGGATTCT
 
. : . : . : . : . : . :
JMFS130A01+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
JMFS032F09+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
JMFS081F04+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
JMFS106E03+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
JMFS091D09+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
JMFS018B10+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
JMFS030H04+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
JMFS131H06+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
JMFS010H04+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
JMFS069D03+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
JMFS079E05+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
JMFS012C11+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
JMFS124G06+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
JMFS149E01+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
JMFS147F10+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
JMFS105A09+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
JMFS145D10+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
JMFS089A10+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
JMFS074F11+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
JMFS131E04+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
JMFS099A06+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
JMFS145F03+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
JMFS007G07+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
JMFS128H09+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
JMFS140E06+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
JMFS087H08+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
JMFS131D09+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
JMFS062C05+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
JMFS098H07+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
JMFS060B01+ TCNTATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
JMFS102A01+ TC-TATGTTATTTTTATTTTCATACTGGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
JMFS044F07+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATNTGCAGCACTGTTGAG
JMFS042D09+ TC-TATGTATTTTANNTTTTCATANCTGATAGGGGTGTTGCTATNTGCAGCACTGTTGAG
JMFS049G12+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
JMFS150B09+ GTTGCTATTTGCAGCACTGTTGAG
JMFS021B02+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
JMFS067H03+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATNTGCAGCACTGTTGAG
JMFS114A07+ CAGCACTGTTGAG
JMFS064F09+ TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
                      ____________________________________________________________
consensus TC-TATGTTATTTTTATTTTCATTACTGATAGGGGTGTTGCTATTTGCAGCACTGTTGAG
 
. : . : . : . : . : . :
JMFS130A01+ AAACTGAGACACTTGAGCTTTA
JMFS032F09+ AAACTGAGACACTTGAGCTTTAGAATAAAACT
JMFS081F04+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS106E03+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS091D09+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS018B10+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS030H04+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS131H06+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS010H04+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS069D03+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS079E05+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS012C11+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS124G06+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS149E01+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS147F10+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS105A09+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS145D10+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS089A10+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS074F11+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS131E04+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS099A06+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS145F03+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS007G07+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS128H09+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS140E06+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS087H08+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS131D09+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS062C05+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS098H07+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS060B01+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS102A01+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS044F07+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS042D09+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS049G12+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS150B09+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS021B02+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS067H03+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS114A07+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
JMFS064F09+ AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
                      ____________________________________________________________
consensus AAACTGAGACACTTGAGCTTTAGAATAAAACTTTCGTCCAGATGGACTGATGTAACACTT
 
. : . : . : . : . : . :
JMFS081F04+ GTAAGTGCTACCATTGTGTGA
JMFS106E03+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCA
JMFS091D09+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAG
JMFS018B10+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
JMFS030H04+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
JMFS131H06+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
JMFS010H04+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
JMFS069D03+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
JMFS079E05+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
JMFS012C11+ GTAAGTACTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
JMFS124G06+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
JMFS149E01+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
JMFS147F10+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
JMFS105A09+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
JMFS145D10+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
JMFS089A10+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
JMFS074F11+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
JMFS131E04+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
JMFS099A06+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
JMFS145F03+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
JMFS007G07+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
JMFS128H09+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
JMFS140E06+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
JMFS087H08+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
JMFS131D09+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
JMFS062C05+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
JMFS098H07+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
JMFS060B01+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
JMFS102A01+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
JMFS044F07+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
JMFS042D09+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
JMFS049G12+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
JMFS023H03+ TTGACCGAGTTTTCGACTCAAGTGTCCATACAGA
JMFS150B09+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGA
JMFS021B02+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
JMFS067H03+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
JMFS114A07+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
JMFS064F09+ GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
                      ____________________________________________________________
consensus GTAAGTGCTACCATTGTGTGAGCCAGTTGACCGAGTTTTCAACTCAACTGTCCATCCAGG
 
. : . : . : . : . : . :
JMFS018B10+ AGGTAACCAATCTGAAGATTGATTTGT
JMFS030H04+ AGGTAACCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTT
JMFS131H06+ AGGTAACCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTTTGAACTTGGCGAAGGTGA
JMFS010H04+ AGGTAACCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTTTGAACTTGGCGAAGGTGA
JMFS069D03+ AGGTAACCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTTTGAACTTGGCGAAGGTGA
JMFS079E05+ AGGTAACCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTTTGAACTTGGCGAAGGTGA
JMFS012C11+ AGGTAACCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTTTGAACTTGGCGAAGGTGA
JMFS124G06+ AGGTAACCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTTTGAACTTGGCGAAGGTGA
JMFS149E01+ AGGTAACCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTTTGAACTTGGCGAAGGTGA
JMFS147F10+ AGGTAACCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTTTGAACTTGGCGAAGGTGA
JMFS105A09+ AGGTAACCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTTTGAACTTGGCGAAGGTGA
JMFS145D10+ AGGTAACCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTTTGAACTTGGCGAAGGTGA
JMFS089A10+ AGGTAACCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTTTGAACTTGGCGAAGGTGA
JMFS074F11+ AGGTAACCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTTTGAACTTGGCGAAGGTGA
JMFS131E04+ AGGTAACCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTTTGAACTTGGCGAAGGTGA
JMFS099A06+ AGGTAACCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTTTGAACTTGGCGAAGGTGA
JMFS145F03+ AGGTAACCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTTTGAACTTGGCGAAGGTGA
JMFS007G07+ AGGTAACCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTTTGAACTTGGCGAAGGTGA
JMFS128H09+ AGGTAACCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTTTGAACTTGGCGAAGGTGA
JMFS140E06+ AGGTAACCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTTTGAACTTGGCGAAGGTGA
JMFS087H08+ AGGTAACCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTTTGAACTTGGCGAAGGTGA
JMFS131D09+ AGGTAACCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTTTGAACTTGGCGAAGGTGA
JMFS062C05+ AGGTAACCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTTTGAACTTGGCGAAGGTGA
JMFS098H07+ AGGTAACCAATCTGAAGATTGATTTGTGTTTGATACAAGCTTTGAACTTGGCGAAGGTGA
JMFS060B01+ AGGTAACCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTTTGAACTTGGCGAAGGTGA
JMFS102A01+ AGGTAACCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTTTGAACTTGGCGAAGGTGA
JMFS044F07+ AGGTAACCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTTTGAACTTGGCGAAGGTGA
JMFS042D09+ AGGTAACCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTTTGAACTTGGCGAAGGTGA
JMFS049G12+ AGGTAACCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTTTGAACTTGGCGAAGGTGA
JMFS023H03+ AGGTATCCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTTTGATCTTGCCCAAGGTGA
JMFS150B09+ AGGTAACCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTTTGAACTTGGCGAAGGTGA
JMFS021B02+ AGGTAACCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTTTGAACTTGGCGAAGGTGA
JMFS067H03+ AGGTAACCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTTTGAACTTGGCGAAGGTGA
JMFS114A07+ AGGTAACCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTTTGAACTTGGCGAAGGTGA
JMFS064F09+ AGGTAACCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTTTGAACTTGGCGAAGGTGA
                      ____________________________________________________________
consensus AGGTAACCAATCTGAAGATTGATTTGTGTTTGATGCAAGCTTTGAACTTGGCGAAGGTGA
 
. : . : . : . : . : . :
JMFS131H06+ AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
JMFS010H04+ AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
JMFS069D03+ AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
JMFS079E05+ AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
JMFS012C11+ AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
JMFS124G06+ AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
JMFS149E01+ AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
JMFS147F10+ AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
JMFS105A09+ AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
JMFS145D10+ AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
JMFS089A10+ AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
JMFS074F11+ AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
JMFS131E04+ AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
JMFS099A06+ AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
JMFS145F03+ AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
JMFS007G07+ AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
JMFS128H09+ AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
JMFS140E06+ AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
JMFS087H08+ AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
JMFS131D09+ AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
JMFS062C05+ AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
JMFS098H07+ AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
JMFS060B01+ AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
JMFS102A01+ AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
JMFS044F07+ AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
JMFS042D09+ AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
JMFS049G12+ AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
JMFS023H03+ AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
JMFS150B09+ AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
JMFS021B02+ AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
JMFS067H03+ AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
JMFS114A07+ AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
JMFS064F09+ AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
                      ____________________________________________________________
consensus AGTAGTACTTCTTTTGGAGCGTCTACTCTCAGGTTTGGGGGTTTCTTGATTTGGAACATC
 
. : . : . : . : . : . :
JMFS131H06+ ACCATTATTGATTCCT-TGATTTTGACCA
JMFS010H04+ ACCATTATTGATTCCT-TGATTTTGACCATCA
JMFS069D03+ ACCATTATTGATTCCT-TGATTTTGACCATCACCATTACCAATTCCTTGAATTTGAGT
JMFS079E05+ ACCATTATTGATTCCT-TGATTTTGACCATCACCATTACCAATTCCTTGAATTTGAGTT
JMFS012C11+ ACCATTATTGATTCCT-TGATTTTGACCATCACCATTACCAATTCCTTGAATTTGAGTTT
JMFS124G06+ ACCATTATTGATTCCT-TGATTTTGACCATCACCATTACCAATTCCTTGAATTTGAGTTT
JMFS149E01+ ACCATTATTGATTCCT-TGATTTTGACCATCACCATTACCAATTCCTTGAATTTGAGTTT
JMFS147F10+ ACCATTATTGATTCCT-TGATTTTGACCATCACCATTACCAATTCCTTGAATTTGAGTTT
JMFS105A09+ ACCATTATTGATTCCT-TGATTTTGACCATCACCATTACCAATTCCTTGAATTTGAGTTT
JMFS145D10+ ACCATTATTGATTCCT-TGATTTTGACCATCACCATTACCAATTCCTTGAATTTGAGTTT
JMFS089A10+ ACCATTATTGATTCCT-TGATTTTGACCATCACCATTACCAATTCCTTGAATTTGAGTTT
JMFS074F11+ ACCATTATTGATTCCT-TGATTTTGACCATCACCATTACCAATTCCTTGAATTTGAGTTT
JMFS131E04+ ACCATTATTGATTCCT-TGATTTTGACCATCACCATTACCAATTCCTTGAATTTGAGTTT
JMFS099A06+ ACCATTATTGATTCCT-TGATTTTGACCATCACCATTACCAATTCCTTGAATTTGAGTTT
JMFS145F03+ ACCATTATTGATTCCT-TGATTTTGACCATCACCATTACCAATTCCTTGAATTTGAGTTT
JMFS007G07+ ACCATTATTGATTCCT-TGATTTTGACCATCACCATTACCAATTCCTTGAATTTGAGTTT
JMFS128H09+ ACCATTATTGATTCCT-TGATTTTGACCATCACCATTACCAATTCCTTGAATTTGAGTTT
JMFS140E06+ ACCATTATTGATTCCT-TGATTTTGACCATCACCATTACCAATTCCTTGAATTTGAGTTT
JMFS087H08+ ACCATTATTGATTCCT-TGATTTTGACCATCACCATTACCAATTCCTTGAATTTGAGTTT
JMFS131D09+ ACCATTATTGATTCCT-TGATTTTGACCATCACCATTACCAATTCCTTGAATTTGAGTTT
JMFS062C05+ ACCATTATTGATTCCT-TGATTTTGACCATCACCATTACCAATTCCTTGAATTTGAGTTT
JMFS098H07+ ACCATTATTGATTCCT-TGATTTTGACCATCACCATTACCAATTCCTTGAATTTGAGTTT
JMFS060B01+ ACCATTATTGATTCCT-TGATTTTGACCATCACCATTACCAATTCCTTGAATTTGAGTTT
JMFS102A01+ ACCATTATTGATTCCT-TGATTTTGACCATCACCATTACCAATTCCTTGAATTTGAGTTT
JMFS044F07+ ACCATTATTGATTCCT-TGATTTTGACCATCACCATTACCAATTCCTTGAATTTGAGTTT
JMFS042D09+ ACCATTATTGATTCCT-TGATTTTGACCATCACCATTACCAATTCCTTGAATTTGAGTTT
JMFS049G12+ ACCATTATTGATTCCT-TGATTTTGACCATCACCATTACCAATTCCTTGAATTTGAGTTT
JMFS023H03+ ACCATTATTGATTCCTATGATTTTGACCATCCCCATTACCAATTCCTTGAATTTGAGTTT
JMFS150B09+ ACCATTATTGATTCCT-TGATTTTGACCATCACCATTACCAATTCCTTGAATTTGAGTTT
JMFS021B02+ ACCATTATTGATTCCT-TGATTTTGACCATCACCATTACCAATTCCTTGAATTTGAGTTT
JMFS067H03+ ACCATTATTGATTCCT-TGATTTTGACCATCACCATTACCAATTCCTTGAATTTGAGTTT
JMFS114A07+ ACCATTATTGATTCCT-TGATTTTGACCATCACCATTACCAATTCCTTGAATTTGAGTTT
JMFS064F09+ ACCATTATTGATTCCT-TGATTTTGACCATCACCATTACCAATTCCTTGAATTTGAGTTT
                      ____________________________________________________________
consensus ACCATTATTGATTCCT-TGATTTTGACCATCACCATTACCAATTCCTTGAATTTGAGTTT
 
. : . : . : . : . : . :
JMFS012C11+ CACCATTATT
JMFS124G06+ CACCATTATTGATTCCTTGATTTTGACCATAGTTAACATCTC
JMFS149E01+ CACCATTATTGATTCCTTGATTTTGACCATAGTTAACATCTCCCGCCTTCA
JMFS147F10+ CACCATTATTGATTCCTTGATTTTGACCATAGTTAACATCTCCCGCCTTCACAAGGTTTA
JMFS105A09+ CACCATTATTGATTCCTTGATTTTGACCATAGTTAACATCTCCCGCCTTCACAAGGTTTA
JMFS145D10+ CACCATTATTGATTCCTTGATTTTGACCATAGTTAACATCTCCCGCCTTCACAAGGTTTA
JMFS089A10+ CACCATTATTGATTCCTTGATTTTGACCATAGTTAACATCTCCCGCCTTCACAAGGTTTA
JMFS074F11+ CACCATTATTGATTCCTTGATTTTGACCATAGTTAACATCTCCCGCCTTCACAAGGTTTA
JMFS131E04+ CACCATTATTGATTCCTTGATTTTGACCATAGTTAACATCTCCCGCCTTCACAAGGTTTA
JMFS099A06+ CACCATTATTGATTCCTTGATTTTGACCATAGTTAACATCTCCCGCCTTCACAAGGTTTA
JMFS145F03+ CACCATTATTGATTCCTTGATTTTGACCATAGTTAACATCTCCCGCCTTCACAAGGTTTA
JMFS007G07+ CACCATTATTGATTCCTTGATTTTGACCATAGTTAACATCTCCCGCCTTCACAAGGTTTA
JMFS128H09+ CACCATTATTGATTCCTTGATTTTGACCATAGTTAACATCTCCCGCCTTCACAAGGTTTA
JMFS140E06+ CACCATTATTGATTCCTTGATTTTGACCATAGTTAACATCTCCCGCCTTCACAAGGTTTA
JMFS087H08+ CACCATTATTGATTCCTTGATTTTGACCATAGTTAACATCTCCCGCCTTCACAAGGTTTA
JMFS131D09+ CACCATTATTGATTCCTTGATTTTGACCATAGTTAACATCTCCCGCCTTCACAAGGTTTA
JMFS062C05+ CACCATTATTGATTCCTTGATTTTGACCATAGTTAACATCTCCCGCCTTCACAAGGTTTA
JMFS098H07+ CACCATTATTGATTCCTTGATTTTGACCATAGTTAACATCTCCCGCCTTCACAAGGTTTA
JMFS060B01+ CACCATTATTGATTCCTTGATTTTGACCATAGTTAACATCTCCCGCCTTCACAAGGTTTA
JMFS102A01+ CACCATTATTGATTCCTTGATTTTGACCATAGTTAACATCTCCCGCCTTCACAAGGTTTA
JMFS044F07+ CACCATTATTGATTCCTTGATTTTGACCATAGTTAACATCTCCCGCCTTCACAAGGTTTA
JMFS042D09+ CACCATTATTGATTCCTTGATTTTGACCATAGTTAACATCTCCCGCCTTCACAAGGTTTA
JMFS049G12+ CACCATTATTGATTCCTTGATTTTGACCATAGTTAACATCTCCCGCCTTCACAAGGTTTA
JMFS023H03+ CACCATTATTGATTCCTTGATTTTGACCATAGTTAACATCTCCCGCCTTCCCAAGGTTTA
JMFS150B09+ CACCATTATTGATTCCTTGATTTTGACCATAGTTAACATCTCCCGCCTTCACAAGGTTTA
JMFS021B02+ CACCATTATTGATTCCTTGATTTTGACCATAGTTAACATCTCCCGCCTTCACAAGGTTTA
JMFS067H03+ CACCATTATTGATTCCTTGATTTTGACCATAGTTAACATCTCCCGCCTTCACAAGGTTTA
JMFS114A07+ CACCATTATTGATTCCTTGATTTTGACCATAGTTAACATCTCCCGCCTTCACAAGGTTTA
JMFS064F09+ CACCATTATTGATTCCTTGATTTTGACCATAGTTAACATCTCCCGCCTTCACAAGGTTTA
                      ____________________________________________________________
consensus CACCATTATTGATTCCTTGATTTTGACCATAGTTAACATCTCCCGCCTTCACAAGGTTTA
 
. : . : . : . : . : . :
JMFS147F10+ TCACAGCCTTCCTGGAATAAAATTTTTTCCCATTTTCCCCATTTGTGTAGTACTTGATCG
JMFS105A09+ TCACAGCCTTCCTGGAATAAAATTTTTTCCCATTTTCCCCATTTGTGTAGTACTTGATCG
JMFS145D10+ TCACAGCCTTCCTGGAATAAAATTTTTTCCCATTTTCCCCATTTGTGTAGTACTTGATCG
JMFS089A10+ TCACAGCCTTCCTGGAATAAAATTTTTTCCCATTTTCCCCATTTGTGTAGTACTTGATCG
JMFS074F11+ TCACAGCCTTCCTGGAATAAAATTTTTTCCCATTTTCCCCATTTGTGTAGTACTTGATCG
JMFS131E04+ TCACAGCCTTCCTGGAATAAAATTTTTTCCCATTTTCCCCATTTGTGTAGTACTTGATCG
JMFS099A06+ TCACAGCCTTCCTGGAATAAAATTTTTTCCCATTTTCCCCATTTGTGTAGTACTTGATCG
JMFS145F03+ TCACAGCCTTCCTGGAATAAAATTTTTTCCCATTTTCCCCATTTGTGTAGTACTTGATCG
JMFS007G07+ TCACAGCCTTCCTGGAATAAAATTTTTTCCCATTTTCCCCATTTGTGTAGTACTTGATCG
JMFS128H09+ TCACAGCCTTCCTGGAATAAAATTTTTTCCCATTTTCCCCATTTGTGTAGTACTTGATCG
JMFS140E06+ TCACAGCCTTCCTGGAATAAAATTTTTTCCCATTTTCCCCATTTGTGTAGTACTTGATCG
JMFS087H08+ TCACAGCCTTCCTGGAATAAAATTTTTTCCCATTTTCCCCATTTGTGTAGTACTTGATCG
JMFS131D09+ TCACAGCCTTCCTGGAATAAAATTTTTTCCCATTTTCCCCATTTGTGTAGTACTTGATCG
JMFS062C05+ TCACAGCCTTCCTGGAATAAAATTTTTTCCCATTTTCCCCATTTGTGTAGTACTTGATCG
JMFS098H07+ TCACAGCCTTCCTGGAATAAAATTTTTTCCCATTTTCCCCATTTGTGTAGTACTTGATCG
JMFS060B01+ TCACAGCCTTCCTGGAATAAAATTTTTTCCCATTTTCCCCATTTGTGTAGTACTTGATCG
JMFS102A01+ TCACAGCCTTCCTGGAATAAAATTTTTTCCCATTTTCCCCATTTGTGTAGTACTTGATCG
JMFS044F07+ TCACAGCCTTCCTGGAATAAAATTTTTTCCCATTTTCCCCATTTGTGTAGTACTTGATCG
JMFS042D09+ TCACAGCCTTCCTGGAATAAAATTTTTTCCCATTTTCCCCATTTGTGTAGTACTTGATCG
JMFS049G12+ TCACAGCCTTCCTGGAATAAAATTTTTTCCCATTTTCCCCATTTGTGTAGTACTTGATCG
JMFS023H03+ TCTCAGCCTTCCTGGAATAAAATTTTTTCCCATTTTCCCCATTTGTGTAGTACTTGATAG
JMFS150B09+ TCACAGCCTTCCTGGAATAAAATTTTTTCCCATTTTCCCCATTTGTGTAGTACTTGATCG
JMFS021B02+ TCACAGCCTTCCTGGAATAAAATTTTTTCCCATTTTCCCCATTTGTGTAGTACTTGATCG
JMFS067H03+ TCACAGCCTTCCTGGAATAAAATTTTTTCCCATTTTCCCCATTTGTGTAGTACTTGATCG
JMFS114A07+ TCACAGCCTTCCTGGAATAAAATTTTTTCCCATTTTCCCCATTTGTGTAGTACTTGATCG
JMFS064F09+ TCACAGCCTTCCTGGAATAAAATTTTTTCCCATTTTCCCCATTTGTGTAGTACTTGATCG
                      ____________________________________________________________
consensus TCACAGCCTTCCTGGAATAAAATTTTTTCCCATTTTCCCCATTTGTGTAGTACTTGATCG
 
. : . : . : . : . : . :
JMFS147F10+ TACGACCGTTTTTTACTTGCACATGCTCGATCCATCCGGGAGGAAGAGGCTCCGGAGATT
JMFS105A09+ TACGACCGTTTTTTACTTGCACATGCTCGATCCATCCGGGAGGAAGAGGCTCCGGAGATT
JMFS145D10+ TACGACCGTTTTTTACTTGCACATGCTCGATCCATCCGGGAGGAAGAGGCTCCGGAGATT
JMFS089A10+ TACGACCGTTTTTTACTTGCACATGCTCGATCCATCCGGGAGGAAGAGGCTCCGGAGATT
JMFS074F11+ TACGACCGTTTTTTACTTGCACATGCTCGATCCATCCGGGAGGAAGAGGCTCCGGAGATT
JMFS131E04+ TACGACCGTTTTTTACTTGCACATGCTCGATCCATCCGGGAGGAAGAGGCTCCGGAGATT
JMFS099A06+ TACGACCGTTTTTTACTTGCACATGCTCGATCCATCCGGGAGGAAGAGGCTCCGGAGATT
JMFS145F03+ TACGACCGTTTTTTACTTGCACATGCTCGATCCATCCGGGAGGAAGAGGCTCCGGAGATT
JMFS007G07+ TACGACCGTTTTTTACTTGCACATGCTCGATCCATCCGGGAGGAAGAGGCTCCGGAGATT
JMFS128H09+ TACGACCGTTTTTTACTTGCACATGCTCGATCCATCCGGGAGGAAGAGGCTCCGGAGATT
JMFS140E06+ TACGACCGTTTTTTACTTGCACATGCTCGATCCATCCGGGAGGAAGAGGCTCCGGAGATT
JMFS087H08+ TACGACCGTTTTTTACTTGCACATGCTCGATCCATCCGGGAGGAAGAGGCTCCGGAGATT
JMFS131D09+ TACGACCGTTTTTTACTTGCACATGCTCGATCCATCCGGGAGGAAGAGGCTCCGGAGATT
JMFS062C05+ TACGACCGTTTTTTACTTGCACATGCTCGATCCATCCGGGAGGAAGAGGCTCCGGAGATT
JMFS098H07+ TACGACCGTTTTTTACTTGCACATGCTCGATCCATCCGGGAGGAAGAGGCTCCGGAGATT
JMFS060B01+ TACGACCGTTTTTTACTTGCACATGCTCGATCCATCCGGGAGGAAGAGGCTCCGGAGATT
JMFS102A01+ TACGACCGTTTTTTACTTGCACATGCTCGATCCATCCGGGAGGAAGAGGCTCCGGAGATT
JMFS044F07+ TACGACCGTTTTTTACTTGCACATGCTCGATCCATCCGGGAGGAAGAGGCTCCGGAGATT
JMFS042D09+ TACGACCGTTTTTTACTTGCACATGCTCGATCCATCCGGGAGGAAGAGGCTCCGGAGATT
JMFS049G12+ TACGACCGTTTTTTACTTGCACATGCTCGATCCATCCGGGAGGAAGAGGCTCCGGAGATT
JMFS023H03+ TACGACCGTTTTTTACTTGCACATGCTCGATCCATCCGGAAGAAAGAGGCTCCGGAGATT
JMFS150B09+ TACGACCGTTTTTTACTTGCACATGCTCGATCCATCCGGGAGGAAGAGGCTCCGGAGATT
JMFS021B02+ TACGACCGTTTTTTACTTGCACATGCTCGATCCATCCGGGAGGAAGAGGCTCCGGAGATT
JMFS067H03+ TACGACCGTTTTTTACTTGCACATGCTCGATCCATCCGGGAGGAAGAGGCTCCGGAGATT
JMFS114A07+ TACGACCGTTTTTTACTTGCACATGCTCGATCCATCCGGGAGGAAGAGGCTCCGGAGATT
JMFS064F09+ TACGACCGTTTTTTACTTGCACATGCTCGATCCATCCGGGAGGAAGAGGCTCCGGAGATT
                      ____________________________________________________________
consensus TACGACCGTTTTTTACTTGCACATGCTCGATCCATCCGGGAGGAAGAGGCTCCGGAGATT
 
. : . : . : . : . : . :
JMFS147F10+ TTCCGGCGA
JMFS105A09+ TTCCGGCGACCATGTTG
JMFS145D10+ TTCCGGCGACCATGTTGCCAGAATATCAA
JMFS089A10+ TTCCGGCGACCATGTTGCCAGAATATCAAGATTC
JMFS074F11+ TTCCGGCGACGATGTTGCCAGAATATCAAGATTCTGTGAAAAAGTGGTGA
JMFS131E04+ TTCCGGCGACCATGTTGCCAGAATATCAAGATTCTGTG
JMFS099A06+ TTCCGGCGACCATGTTGCCAGAATATCAAGATTCTGTGAAAAAGTGGTGACAA
JMFS145F03+ TTCCGGCGACCATGTTGCCAGAATATCAAGATTCTGTGAAAAAGTGGTGACAAG
JMFS007G07+ TTCCGGCGACCATGTTGCCAGAATATCAAGATTCTGTGAAAAAGTGGTGACAAG
JMFS128H09+ TTCCGGCGACCATGTTGCCAGAATATCAAGATTCTGT-AAAAAGTGGTGACAAGAT
JMFS140E06+ TTCCGGCGACCATGTTGCCAGAATATCAAGATTCTGTGAAAAAGTGGTGACAAGATTAA
JMFS087H08+ TTCCGGCGACCATGTTGCCAGAATATCAAGATTCTGTGAAAAAGTGGTGACAAGATTAA
JMFS131D09+ TTCCGGCGACCATGTTGCCAGAATATCAAGATTCTGTGAAAAAGTGGTGACAAGATTAA
JMFS062C05+ TTCCGGCGACCATGTTGCCAGAATATCAAGATTCTGTGAAAAAGTGGTGACAAGATTAA
JMFS098H07+ TTCCGGCGACCATGTTGCCAGAATATCAAGATTCTGTGAAAAAGTGGTGACAAGATTAA
JMFS060B01+ TTCCGGCGACCATGTTGCCAGAATATCAAGATTCTGTGAAAAAGTGGTGACAAGATTAA
JMFS102A01+ TTCCGGCGACCATGTTGCCAGAATATCAAGATTCTGTGAAAAAGTGGTGACAAGATTAA
JMFS044F07+ TTCCGGCGACCATGTTGCCAGAATATCAAGATTCTGT-AAAAAGTGGTGACAAGATTAA
JMFS042D09+ TTCCGGCGACCATGTTGCCAGAATATCAAGATTCTGTGAAAAAGTGGTGACAAGATTAA
JMFS049G12+ TTCCGGCGACCATGTTGCCAGAATATCAAGATTCTGT
JMFS023H03+ T
JMFS150B09+ TTCCGGCGACCATGTTGCCAGAATATCAAGATTCTGT-AAAAAGTGGTGACAAGATTAA
JMFS021B02+ TTCCGGCGACCATGTTGCCAGAATATCAAGATTCTGT-AAAAAGTGGTGACAAGATTAA
JMFS067H03+ TTCCGGCGACCATGTTGCCAGAATATCAAGATTCTGTGAAAAAGTGGTGACAAGATTAA
JMFS114A07+ TTCCGGCGACCATGTTGCCAGAATATCAAGATTCTGTGAAAAAGTGGTGACAAGATTAA
JMFS064F09+ TTCCGGCGACCATGTTGCCAGAATATCAAGATTCTGTGAAAAAGTGGTGACAAGATTAAG
                      ____________________________________________________________
consensus TTCCGGCGACCATGTTGCCAGAATATCAAGATTCTGTGAAAAAGTGGTGACAAGATTAAG