Previous Contig 003386:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS064A02Sequence627003386 (2)gb:AK118280_18162671e-31Arabidopsis thaliana At5g51740 mRNA for unknown protein, complete cds, clone: RA
JMSF051H15Sequence621003386 (2)gb:AK118280_18162677e-34Arabidopsis thaliana At5g51740 mRNA for unknown protein, complete cds, clone: RA779024464gb:AK118280_18162674e-76Arabidopsis thaliana At5g51740 mRNA for unknown protein, complete cds, clone: RA

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF051H15+ CTCTGCAGAGCCCCAATTATGTCGCTAGCTATCAACCTTACTCTTA
JMFS064A02+ TGTCGCTAGCTATCAACCTTACTCTTA
                      ____________________________________________________________
consensus CTCTGCAGAGCCCCAATTATGTCGCTAGCTATCAACCTTACTCTTA
 
. : . : . : . : . : . :
JMSF051H15+ CACTTTCCGGGTGAATCGCGGGGAGGATTTTCCCCTTGAAACTCGCTTTCATCTGCTTAA
JMFS064A02+ CACTTTCCGGGTGAATCGCGGGGAGGATTTTCCCCTTGAAACTCGCTTTCATCTGCTTAA
                      ____________________________________________________________
consensus CACTTTCCGGGTGAATCGCGGGGAGGATTTTCCCCTTGAAACTCGCTTTCATCTGCTTAA
 
. : . : . : . : . : . :
JMSF051H15+ ATTGAGTCTCTCCAAGCTCCCTCTCCATGCTTCTGGACAAGAGCACGAAATGGGTGCGCT
JMFS064A02+ ATTGAGTCTCTCCAAGCTCCCTCTCCATGCTTCTGGACAAGAGCACGAAATGGGTGCGCT
                      ____________________________________________________________
consensus ATTGAGTCTCTCCAAGCTCCCTCTCCATGCTTCTGGACAAGAGCACGAAATGGGTGCGCT
 
. : . : . : . : . : . :
JMSF051H15+ TTGTATAAGGTATAGTCTCTACATGCCCGGCGTAAATCGTGATGGCGAGCCCTGAACCCA
JMFS064A02+ TTGTATAAGGTATAGTCTCTACATGCCCGGCGTAAATCGTGATGGCGAGCCCTGAACCCA
                      ____________________________________________________________
consensus TTGTATAAGGTATAGTCTCTACATGCCCGGCGTAAATCGTGATGGCGAGCCCTGAACCCA
 
. : . : . : . : . : . :
JMSF051H15+ CCACAACAACGATGAACACATTCCTAGGGTTCTGAAACCAGCGCTGCGGCCCTCGGGGAC
JMFS064A02+ CCACAACAACGATGAACACATTCCTAGGGTTCTGAAACCAGCGCTGCGGCCCTCGGGGAC
                      ____________________________________________________________
consensus CCACAACAACGATGAACACATTCCTAGGGTTCTGAAACCAGCGCTGCGGCCCTCGGGGAC
 
. : . : . : . : . : . :
JMSF051H15+ GAAAGTGGCGGACTTGGTACCGATCCACATAGTAATATCTCCTCGCCTGAGCAAGAAAAG
JMFS064A02+ GAAAGTGGCGGACTTGGTACCGATCCACATAGTAATATCTCCTCGCCTGAGCAAGAAAAG
                      ____________________________________________________________
consensus GAAAGTGGCGGACTTGGTACCGATCCACATAGTAATATCTCCTCGCCTGAGCAAGAAAAG
 
. : . : . : . : . : . :
JMSF051H15+ GGCTGCTTGTATGCTGAAACCCTGATTGACATTTTGAGCTCCTCAAAACAGGCGAGGAAA
JMFS064A02+ GGCTGCTTGTATGCTGAAACCCTGATTGACATTTTGAGCTCCTCAAAACAGGCGAGGAAA
                      ____________________________________________________________
consensus GGCTGCTTGTATGCTGAAACCCTGATTGACATTTTGAGCTCCTCAAAACAGGCGAGGAAA
 
. : . : . : . : . : . :
JMSF051H15+ AACGAGAGAACCCAGATTCGAAAGAACTGTACTGTTTGGTGCCTGAAATGGATTCGGAGA
JMFS064A02+ AACGAGAGAACCCAGATTCGAAAGAACTGTACTGTTTGGTGCCTGAAATGGATTCGGAGA
                      ____________________________________________________________
consensus AACGAGAGAACCCAGATTCGAAAGAACTGTACTGTTTGGTGCCTGAAATGGATTCGGAGA
 
. : . : . : . : . : . :
JMSF051H15+ CGCGATTTTTGGACGAAATCTTTGACGCTAAGCTCCTGAATGCATCGAATGCGAATCTTG
JMFS064A02+ CGCGATTTTTGGACGAAATCTTTGACGCTAAGCTCCTGAATGCATCGAATGCGAATCTTG
                      ____________________________________________________________
consensus CGCGATTTTTGGACGAAATCTTTGACGCTAAGCTCCTGAATGCATCGAATGCGAATCTTG
 
. : . : . : . : . : . :
JMSF051H15+ ATCTTCTATGCCATCCCATTGTACTGTAGAGAAAGATATAATTGGCTTCAACGTATGTGA
JMFS064A02+ ATCTTCTATGCCATCCCATTGTACTGTAGAGAAAGATATAATTGGCTTCAACGTATGTGA
                      ____________________________________________________________
consensus ATCTTCTATGCCATCCCATTGTACTGTAGAGAAAGATATAATTGGCTTCAACGTATGTGA
 
. : . : . : . : . : . :
JMSF051H15+ GTGTAGATGAAAATCATTAAGAACTGGATTTCTT
JMFS064A02+ GTGTAGATGAAAATCATTAAGAACTGGATTTCTTGGAGGAAAATCTAGAACTTTTCTGTT
                      ____________________________________________________________
consensus GTGTAGATGAAAATCATTAAGAACTGGATTTCTTGGAGGAAAATCTAGAACTTTTCTGTT