Previous Contig 003385:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS063F12Sequence636003385 (4)gb:AC149287_17448894e-49Solanum demissum chromosome 5 clone PGEC568D21 map MAP_LOC, complete sequence.
JMFS070C02Sequence636003385 (4)gb:AC149287_17448894e-49Solanum demissum chromosome 5 clone PGEC568D21 map MAP_LOC, complete sequence.
JMSF048H01Sequence648003385 (4)gb:AC149287_17448893e-57Solanum demissum chromosome 5 clone PGEC568D21 map MAP_LOC, complete sequence.794003385 (4)gb:AC151802_17451112e-50Solanum tuberosum chromosome 5 clone PGEC46 map MAP_LOC, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF048H01- TTGGGATTGTAGTGTTCAAATTAACACCAATAGTAGG
                      ____________________________________________________________
consensus TTGGGATTGTAGTGTTCAAATTAACACCAATAGTAGG
 
. : . : . : . : . : . :
rJMSF048H01- TAAAATATTTTACAACTTAACATGCTTAGCAAAGCTCAGAGCTTGAATAACACAGCTATA
                      ____________________________________________________________
consensus TAAAATATTTTACAACTTAACATGCTTAGCAAAGCTCAGAGCTTGAATAACACAGCTATA
 
. : . : . : . : . : . :
rJMSF048H01- CAAAACATTGAAAAATGGCATATTTTCTCTTTGCTTATTACCCAATCAGAAAAGAACATT
                      ____________________________________________________________
consensus CAAAACATTGAAAAATGGCATATTTTCTCTTTGCTTATTACCCAATCAGAAAAGAACATT
 
. : . : . : . : . : . :
rJMSF048H01- ATTGCCTCCCCACTCCCCAGTAACCTGTCAACTTCACAGCTCTAACAAAGCTCTTGTAGC
                      ____________________________________________________________
consensus ATTGCCTCCCCACTCCCCAGTAACCTGTCAACTTCACAGCTCTAACAAAGCTCTTGTAGC
 
. : . : . : . : . : . :
rJMSF048H01- CATTTCTCCTTGAAGTACTCCCGAAAAAACGTAAAGCCCTAAAATACTAAATGTCTATAA
                      ____________________________________________________________
consensus CATTTCTCCTTGAAGTACTCCCGAAAAAACGTAAAGCCCTAAAATACTAAATGTCTATAA
 
. : . : . : . : . : . :
rJMSF048H01- TCAATCTTTTGTCGCCGTCTCTATCAAGATGCTTGTATGAGTTCTTTGATGTCATATCCT
                      ____________________________________________________________
consensus TCAATCTTTTGTCGCCGTCTCTATCAAGATGCTTGTATGAGTTCTTTGATGTCATATCCT
 
. : . : . : . : . : . :
rJMSF048H01- TGGAGCTGAAGGAAGGTCAGAAGCAAAATAACTCCGGAGTTCCAAAAAGCATGAATAGTA
                      ____________________________________________________________
consensus TGGAGCTGAAGGAAGGTCAGAAGCAAAATAACTCCGGAGTTCCAAAAAGCATGAATAGTA
 
. : . : . : . : . : . :
rJMSF048H01- ATTGGTGTAAGTAGATTTCGGGTTTGAGCATATGAAAATCCTAATGCAGTACCGAGTACA
                      ____________________________________________________________
consensus ATTGGTGTAAGTAGATTTCGGGTTTGAGCATATGAAAATCCTAATGCAGTACCGAGTACA
 
. : . : . : . : . : . :
rJMSF048H01- AAAAGCTGAGGGAATTCTCCCGGTGTCAAATGTGCAGCAGAAAATACAGCAGCGCTGATA
                      ____________________________________________________________
consensus AAAAGCTGAGGGAATTCTCCCGGTGTCAAATGTGCAGCAGAAAATACAGCAGCGCTGATA
 
. : . : . : . : . : . :
rJMSF048H01- AGGACAGCAAGTGGGCTAGGCAGCCACTTCGTCAGGGATACCATCAAAAAGCCTCTAAAC
                      ____________________________________________________________
consensus AGGACAGCAAGTGGGCTAGGCAGCCACTTCGTCAGGGATACCATCAAAAAGCCTCTAAAC
 
. : . : . : . : . : . :
rJMSF048H01- ACCGTCTCCTCAAGAACTGGTGCAAGGACGCCAGTGATACCCAATAGACTCAGAGTGCTG
                      ____________________________________________________________
consensus ACCGTCTCCTCAAGAACTGGTGCAAGGACGCCAGTGATACCCAATAGACTCAGAGTGCTG
 
. : . : . : . : . : . :
rJMSF048H01- ATGCTTGAAGAGCCAATCAATGGAAGCAAGCGAACTAGAGCATCAGTCTCTCTTGTCGGG
JMSF048H01+ GTCGGG
                      ____________________________________________________________
consensus ATGCTTGAAGAGCCAATCAATGGAAGCAAGCGAACTAGAGCATCAGTCTCTCTTGTCGGG
 
. : . : . : . : . : . :
rJMSF048H01- GGTTCACTATTCAAAGAAGACATGGCAACTCCTGTCAGTGCAATAGCAGCCAGTGCTCCA
JMSF048H01+ GGTTCACTATTCAAAGAAGACATGGCAACTCCTGTCAGTGCAATAGCAGCCAGTGCTCCA
JMFS070C02+ GCAACTCCTGTCAGTGCAATAGCAGCCAGTGCTCCA
JMFS063F12+ GCAACTCCTGTCAGTGCAATAGCAGCCAGTGCTCCA
                      ____________________________________________________________
consensus GGTTCACTATTCAAAGAAGACATGGCAACTCCTGTCAGTGCAATAGCAGCCAGTGCTCCA
 
. : . : . : . : . : . :
rJMSF048H01- GCAAGACCAATTGCTGCC
JMSF048H01+ GCAAGACCAATTGCTGCCCAAAACAGCCAACCTCTTTGAAGATTGAATGGCTCCCTCCAA
JMFS070C02+ GCAAGACCAATTGCTGCCCACAACAGCCAACCTCTTTGAAGATTGAATGGCTCCCTCCAA
JMFS063F12+ GCAAGACCAATTGCTGCCCACAACAGCCAACCTCTTTGAAGATTGAATGGCTCCCTCCAA
                      ____________________________________________________________
consensus GCAAGACCAATTGCTGCCCACAACAGCCAACCTCTTTGAAGATTGAATGGCTCCCTCCAA
 
. : . : . : . : . : . :
JMSF048H01+ TCATAACAATATATGTCATTGGGAAGCGGCTTAGATGACTTGGTCAGGGTATAGAGAACT
JMFS070C02+ TCATAACAATATATGTCATTGGGAAGCGGCTTAGATGACTTGGTCAGGGTATAGAGAACT
JMFS063F12+ TCATAACAATATATGTCATTGGGAAGCGGCTTAGATGACTTGGTCAGGGTATAGAGAACT
                      ____________________________________________________________
consensus TCATAACAATATATGTCATTGGGAAGCGGCTTAGATGACTTGGTCAGGGTATAGAGAACT
 
. : . : . : . : . : . :
JMSF048H01+ CCAAGAACAATTGCAGTTGTAATAGCTTGGTCTAGAAACAAAATTTCTGCCTTCTCATCC
JMFS070C02+ CCAAGAACAATTGCAGTTGTAATAGCTTGGTCTAGAAACAAAATTTCTGCCTTCTCATCC
JMFS063F12+ CCAAGAACAATTGCAGTTGTAATAGCTTGGTCTAGAAACAAAATTTCTGCCTTCTCATCC
                      ____________________________________________________________
consensus CCAAGAACAATTGCAGTTGTAATAGCTTGGTCTAGAAACAAAATTTCTGCCTTCTCATCC
 
. : . : . : . : . : . :
JMSF048H01+ AAGCTTAGTTCTTCAACCTGAATTCCTGTGTACGGTATTGCTGCTGTCTCTATTAGTCCT
JMFS070C02+ AAGCTTAGTTCTTCAACCTGAATTCCTGTGTACGGTATTGCTGCTGTCTCTATTAGTCCT
JMFS063F12+ AAGCTTAGTTCTTCAACCTGAATTCCTGTGTACGGTATTGCTGCTGTCTCTATTAGTCCT
                      ____________________________________________________________
consensus AAGCTTAGTTCTTCAACCTGAATTCCTGTGTACGGTATTGCTGCTGTCTCTATTAGTCCT
 
. : . : . : . : . : . :
JMSF048H01+ GTCAAAACAAAACTGAATCCACAAGCAAGGGAAGTAAGAGAAATAGTTTGCCAATTCCAT
JMFS070C02+ GTCAAAACAAAACTGAATCCACAAGCAAGGGAAGTAAGAGAAATAGTTTGCCAATTCCAT
JMFS063F12+ GTCAAAACAAAACTGAATCCACAAGCAAGGGAAGTAAGAGAAATAGTTTGCCAATTCCAT
                      ____________________________________________________________
consensus GTCAAAACAAAACTGAATCCACAAGCAAGGGAAGTAAGAGAAATAGTTTGCCAATTCCAT
 
. : . : . : . : . : . :
JMSF048H01+ GGAACACTCCACCGTCTAAAAATTGGACAATTGGGTCCACTTCCTTTAGGGTCGGGTCGA
JMFS070C02+ GGAACACTCCACCGTCTAAAAATTGGACAATTGGGTCCACTTCCTTTAGGGTCGGGTCGA
JMFS063F12+ GGAACACTCCACCGTCTAAAAATTGGACAATTGGGTCCACTTCCTTTAGGGTCGGGTCGA
                      ____________________________________________________________
consensus GGAACACTCCACCGTCTAAAAATTGGACAATTGGGTCCACTTCCTTTAGGGTCGGGTCGA
 
. : . : . : . : . : . :
JMSF048H01+ TTTCCGGATGAGTAAGAACAAACAGTAGTAGAGAAGCGCGGTCTGAGAGCTTGGTCGGTC
JMFS070C02+ TTTCCGGATGAGTAAGAACAAACAGTAGTAGAGAAGCGCGGTCTGAGAGCTTGGTCGGTC
JMFS063F12+ TTTCCGGATGAGTAAGAACAAACAGTAGTAGAGAAGCGCGGTCTGAGAGCTTGGTCGGTC
                      ____________________________________________________________
consensus TTTCCGGATGAGTAAGAACAAACAGTAGTAGAGAAGCGCGGTCTGAGAGCTTGGTCGGTC
 
. : . : . : . : . : . :
JMSF048H01+ CGGCGAAATGAGAGCAATTGCAATTTCTGGGTCAGAGGCTTATATGGAAAAAGCTTTGGT
JMFS070C02+ CGGCGAAATGAGAGCAATTGCAATTTCTGGGTCAGAGGCTTATATGGAAAAAGCTTTGGT
JMFS063F12+ CGGCGAAATGAGAGCAATTGCAATTTCTGGGTCAGAGGCTTATATGGAAAAAGCTTTGGT
                      ____________________________________________________________
consensus CGGCGAAATGAGAGCAATTGCAATTTCTGGGTCAGAGGCTTATATGGAAAAAGCTTTGGT
 
. : . : . : . : . : . :
JMSF048H01+ GAGAGTGATGCAATGGGAGCAGAGGGTCGAGCCAGAGAGACGTAGAACAACGCTGCTGCA
JMFS070C02+ GAGAGTGATGCAATGGGAGCAGAGGGTCGAGCCAGAGAGACGTAGAACAACGCTGCTGCA
JMFS063F12+ GAGAGTGATGCAATGGGAGCAGAGGGTCGAGCCAGAGAGACGTAGAACAACGCTGCTGCA
                      ____________________________________________________________
consensus GAGAGTGATGCAATGGGAGCAGAGGGTCGAGCCAGAGAGACGTAGAACAACGCTGCTGCA
 
. : . : . : . : . : . :
JMSF048H01+ GCCATTTGGAGAATCGTAGGTTGAGAGATAAGGCAGATTAT
JMFS070C02+ GCCATTTGGAGAATCGTAGGTTGAGAGATAAGGCAGATTATGATCAAAGATTTGATTTTG
JMFS063F12+ GCCATTTGGAGAATCGTAGGTTGAGAGATAAGGCAGATTATGATCAAAGATTTGATTTTG
                      ____________________________________________________________
consensus GCCATTTGGAGAATCGTAGGTTGAGAGATAAGGCAGATTATGATCAAAGATTTGATTTTG