Previous Contig 003380:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006E10Sequence471003380 (7)825010222 (5)gb:AP000375_18198227e-89Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MJG19.
JMFF042H08Sequence629003380 (7)gb:AP000375_18198224e-06Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MJG19.621010222 (5)gb:BT006163_16390562e-53Arabidopsis thaliana clone RAFL19-55-C08 (R50766) unknown protein (At1g55930) mR
JMFS062F01Sequence603003380 (7)
JMSF015C17Sequence446003380 (7)781010222 (5)gb:BT006163_16390562e-91Arabidopsis thaliana clone RAFL19-55-C08 (R50766) unknown protein (At1g55930) mR
JMSF032K12Sequence701003380 (7)gb:AP000375_18198224e-12Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MJG19.764010222 (5)gb:BT006163_16390563e-90Arabidopsis thaliana clone RAFL19-55-C08 (R50766) unknown protein (At1g55930) mR
JMSF036J16Sequence647003380 (7)gb:AP000375_18198224e-09Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MJG19.748010222 (5)gb:BT006163_16390563e-88Arabidopsis thaliana clone RAFL19-55-C08 (R50766) unknown protein (At1g55930) mR
JMSF038B16Sequence646003380 (7)gb:AP000375_18198221e-09Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MJG19.870023795gb:AP000375_1819822e-110Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MJG19.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF032K12+ AAAATGCCG
                      ____________________________________________________________
consensus AAAATGCCG
 
. : . : . : . : . : . :
JMSF038B16+ AGAACCGGCA
JMSF032K12+ AAAGCCCGAGAAGCAATGCCAACACCAAACCTTGCTCTTTAAAAACTCTAAGAACCGGCA
JMSF036J16+ AGAACCGGCA
                      ____________________________________________________________
consensus AAAGCCCGAGAAGCAATGCCAACACCAAACCTTGCTCTTTAAAAACTCTAAGAACCGGCA
 
. : . : . : . : . : . :
JMSF038B16+ AAACCTTTGGCCAAAAATTTCTCAAGGCCACAAGAGTTTGGTCCAAAGCCCCGTAGCGCG
JMSF032K12+ AAACCTTTGGCCAAAAATTTCTCAAGGCCACAAGAGTTTGGTCCAAAGCCCCGTAGCGCG
JMFF042H08+ TTGGCCAAAAA-TTCTCAAGGCCACAAGAG-TTGGTCCAAAGCCCCGTAGCGCG
JMSF036J16+ AAACCTTTGGCCAAAAATTTCTCAAGGCCACAAGAGTTTGGTCCAAAGCCCCGTAGCGCG
                      ____________________________________________________________
consensus AAACCTTTGGCCAAAAATTTCTCAAGGCCACAAGAGTTTGGTCCAAAGCCCCGTAGCGCG
 
. : . : . : . : . : . :
JMSF038B16+ CACTGACAACCTCTTCAATAGCAAGCACTCTCCGACAGCCAAACACAAAAACCCCACAAA
JMSF032K12+ CACTGACAACCTCTTCAATAGCAAGCACTCTCCGACAGCCAAACACAAAAACCCCACAAA
JMFF042H08+ CACTGACAACCTCTTCAATAGCAAGCACTCTCCGACAGCCAAACACAAAAACCCCACAAA
JMSF036J16+ CACTGACAACCTCTTCAATAGCAAGCACTCTCCGACAGCCAAACACAAAAACCCCACAAA
JMFS062F01+ AAA
                      ____________________________________________________________
consensus CACTGACAACCTCTTCAATAGCAAGCACTCTCCGACAGCCAAACACAAAAACCCCACAAA
 
. : . : . : . : . : . :
JMSF038B16+ CTAAAGCTACCAAAATCAAACCCCTCTTCAACAAAACCTCCACGAGCCCCACATTCACAC
JMSF032K12+ CTAAAGCTACCAAAATCAAACCCCTCTTCAACAAAACCTCCACGAGCCCCACATTCACAC
JMSF015C17+ CCACATTCACAC
JMFF042H08+ CTAAAGCTACCAAAATCAAACCCCTCTTCAACAAAACCTCCACGAGCCCCACATTCACAC
JMFF006E10+ GCCCCACATTCACAC
JMSF036J16+ CTAAAGCTACCAAAATCAAACCCCTCTTCAACAAAACCTCCACGAGCCCCACATTCACAC
JMFS062F01+ CTAAAGCTACCAAAATCAAACCCCTCTTCAACANAACCTCCACGAGCCCCACATTCACAC
                      ____________________________________________________________
consensus CTAAAGCTACCAAAATCAAACCCCTCTTCAACAAAACCTCCACGAGCCCCACATTCACAC
 
. : . : . : . : . : . :
JMSF038B16+ TCGTTACGCCATCTTCAACATTTCGGCAAGCACAACCGCGACTTACCGATAGCGGGCTCA
JMSF032K12+ TCGTTACGCCATCTTCAACATTTCGGCAAGCACAACCGCGACTTACCGATAGCGGGCTCA
JMSF015C17+ TCGTTACGCCATCTTCAACATTTCGGCAAGCACAACCGCGACTTACCGATAGCGGGCTCA
JMFF042H08+ TCGTTACGCCATCTTCAACATTTCGGCAAGCACAACCGCGACTTACCGATAGCGGGCTCA
JMFF006E10+ TCGTTACGCCATCTTCAACATTTCGGCGAGCACAACCGCGACTTACCGATAGCGGGCTCA
JMSF036J16+ TCGTTACGCCATCTTCAACATTTCGGCAAGCACAACCGCGACTTACCGATAGCGGGCTCA
JMFS062F01+ TCGTTACGCCATCTTCAACATTTCGGCAAGCACAACCGCGACTTACCGATAGCGGGCTCA
                      ____________________________________________________________
consensus TCGTTACGCCATCTTCAACATTTCGGCAAGCACAACCGCGACTTACCGATAGCGGGCTCA
 
. : . : . : . : . : . :
JMSF038B16+ AACCGAGTCGACTCGGATGGAGCTCGGAGTTGAAGAAAATTCTAGAACCGTACGGTACGG
JMSF032K12+ AACCGAGTCGACTCGGATGGAGCTCGGAGTTGAAGAAAATTCTAGAACCGTACGGTACGG
JMSF015C17+ AACCGAGTCGACTCGGATGGAGCTCGGAGTTGAAGAAAATTCTAGAACCGTACGGTACGG
JMFF042H08+ AACCGAGTCGACTCGGATGGAGCTCGGAGTTGAAGAAAATTCTAGAACCGTACGGTACGG
JMFF006E10+ AACCGAGTCGACTCGGATGGAGCTCGGAGTTGAAGAAAATTCTAGAACCGTACGGTACGG
JMSF036J16+ AACCGAGTCGACTCGGATGGAGCTCGGAGTTGAAGAAAATTCTAGAACCGTACGGTACGG
JMFS062F01+ AACCGAGTCGACTCGGATGGAGCTCGGAGTTGAAGAAAATTCTAGAACCGTACGGTACGG
                      ____________________________________________________________
consensus AACCGAGTCGACTCGGATGGAGCTCGGAGTTGAAGAAAATTCTAGAACCGTACGGTACGG
 
. : . : . : . : . : . :
JMSF038B16+ AGTAACCCCCTCTGCCGGCGGATTTTGCAGCGCAGCACAGACTCCTGGCAGAGATACCGG
JMSF032K12+ AGTAACCCCCTCTGCCGGCGGATTTTGCAGCGCAGCACAGACTCCTGGCAGAGATACCGG
JMSF015C17+ AGTAACCCCCTCTGCCGGCGGATTTTGCAGCGCAGCACAGACTCCTGGCAGAGATACCGG
JMFF042H08+ AGTAACCCCCTCTGCCGGCGGATTTTGCAGCGCAGCACAGACTCCTGGCAGAGATACCGG
JMFF006E10+ AGTAACCCCCTCTGCCGGCGGATTTTGCAGCGCAGCACAGACTCCTGGCAGAGATACCGG
JMSF036J16+ AGTAACCCCCTCTGCCGGCGGATTTTGCAGCGCAGCACAGACTCCTGGCAGAGATACCGG
JMFS062F01+ AGTAACCCCCTCTGCCGGCGGATTTTGCAGCGCAGCACAGACTCCTGGCAGAGATACCGG
                      ____________________________________________________________
consensus AGTAACCCCCTCTGCCGGCGGATTTTGCAGCGCAGCACAGACTCCTGGCAGAGATACCGG
 
. : . : . : . : . : . :
JMSF038B16+ CGGAAATCCCGAACCGACGGCTGCGAAGAACTCTGAATGCGGATCGATTCAAGAGATAGG
JMSF032K12+ CGGAAATCCCGAACCGACGGCTGCGAAGAACTCTGAATGCGGATCGATTCAAGAGATAGG
JMSF015C17+ CGGAAATCCCGAACCGACGGCTGCGAAGAACTCTGAATGCGGATCGATTCAAGAGATAGG
JMFF042H08+ CGGAAATCCCGAACCGACGGCTGCGAAGAACTCTGAATGCGGATCGATTCAAGAGATAGG
JMFF006E10+ CGGAAATCCCGAACCGACGGCTGCGAAGAACTCTGAATGCGGATCGATTCAAGAGATAGG
JMSF036J16+ CGGAAATCCCGAACCGACGGCTGCGAAGAACTCTGAATGCGGATCGATTCAAGAGATAGG
JMFS062F01+ CGGAAATCCCGAACCGACGGCTGCGAAGAACTCTGAATGCGGATCGATTCAAGAGATAGG
                      ____________________________________________________________
consensus CGGAAATCCCGAACCGACGGCTGCGAAGAACTCTGAATGCGGATCGATTCAAGAGATAGG
 
. : . : . : . : . : . :
JMSF038B16+ GCTCAAGAGCCGCTACTGCTTCCATGTGGATTCGCAGAAACTATGCGTGAAATTAGAAAA
JMSF032K12+ GCTCAAGAGCCGCTACTGCTTCCATGTGGATTCGCAGAAACTATGCGTGAAATTAGAAAA
JMSF015C17+ GTTCAAGAGCCGCTACTGCTTCCATGTGGATTCGCAGAAACTATGCGTGAAATTAGAAAA
JMFF042H08+ GCTCAAGAGCCGCTACTGCTTCCATGTGGATTCGCAGAAACTATGCGTGAAATTAGAAAA
JMFF006E10+ GCTCAAGAGCCGCTACTGCTTCCATGTGGATTCGCAGAAACTATGCGTGAAATTAGAAAA
JMSF036J16+ GCTCAAGAGCCGCTACTGCTTCCATGTGGATTCGCAGAAACTATGCGTGAAATTAGAAAA
JMFS062F01+ GCTCAAGAGCCGCTACTGCTTCCATGTGGATTCGCAGAAACTATGCGTGAAATTAGAAAA
                      ____________________________________________________________
consensus GCTCAAGAGCCGCTACTGCTTCCATGTGGATTCGCAGAAACTATGCGTGAAATTAGAAAA
 
. : . : . : . : . : . :
JMSF038B16+ ACAAGTGGAAATTCAATCCAAAATTCCAAATAATATACGAGTAGATAGAGCGGGAAGGGT
JMSF032K12+ ACAAGTGGAAATTCAATCCAAAATTCCAAATAATATACGAGTAGATAGAGCGGGAAGGGT
JMSF015C17+ ACAAGTGGAAATTCAATCCAAAATTCCAAATAATATACGAGTAGATAGAGCGGGAAGGGT
JMFF042H08+ ACAAGTGGAAATTCAATCCAAAATTCCAAATAATATACGAGTAGATAGAGCGGGAAGGGT
JMFF006E10+ ACAAGTGGAAATTCAATCCAAAATTCCAAATAATATACGAGTAGATAGAGCGGGAAGGGT
JMSF036J16+ ACAAGTGGAAATTCAATCCAAAATTCCAAATAATATACGAGTAGATAGAGCGGGAAGGGT
JMFS062F01+ ACAAGTGGAAATTCAATCCAAAATTCCAAATAATATACGAGTAGATAGAGCGGGAAGGGT
                      ____________________________________________________________
consensus ACAAGTGGAAATTCAATCCAAAATTCCAAATAATATACGAGTAGATAGAGCGGGAAGGGT
 
. : . : . : . : . : . :
JMSF038B16+ AGAGATTAGATCTTCTTGCGGAGCTTGAAGAGATGGAAACGTGCAGACGAAGAGCTCATC
JMSF032K12+ AGAGATTAGATCTTCTTGCGGAGCTTGAAGAGATGGAAACGTGCAGACGAAGAGCTCATC
JMSF015C17+ AGAGATTAGATCTTCTTGCGGAGCTTGAAGAGATGGAAACGTGCAGACGAAGAGCTCATC
JMFF042H08+ AGAGATTAGATCTTCTTGCGGAGCTTGAAGAGATGGAAACGTGCAGACGAAGAGCTCATC
JMFF006E10+ AGAGATTAGATCTTCTTGCGGAGCTTGAAGAGATGGAAACGTGCAGACGAAGAGCTCATC
JMSF036J16+ AGAGATTAGATCTTCTTGCGGAGCTTGAAGAGATGGAAACGTGCAGACGAAGAGCTCATC
JMFS062F01+ AGAGATTAGATCTTCTTGCGGAGCTTGAAGAGATGGAAACGTGCAGACGAAGAGCTCATC
                      ____________________________________________________________
consensus AGAGATTAGATCTTCTTGCGGAGCTTGAAGAGATGGAAACGTGCAGACGAAGAGCTCATC
 
. : . : . : . : . : . :
JMSF038B16+ CTGCTCGGCCTCTACTGCGAGCTGCGTGGAC
JMSF032K12+ CTGCTCGGCCTCTACTGCGAGCTGCGTGGAC
JMSF015C17+ CTGCTCGGCCTC
JMFF042H08+ CTGCTCGGCCTCTACTGCGAGCTGCGTGGACGACTC
JMFF006E10+ CTGCTCGGCCTCTACTGCGAGCTGCGTGGACGACTC
JMSF036J16+ CTGCTCGGCCTCTACTGCGAGCTGCGTGGACGACTC
JMFS062F01+ CTGCTCGGCCTCTACTGCGAGCTGCGTGGACGACTCAATTTCTTTGCTCGTGTGCTTCTG
                      ____________________________________________________________
consensus CTGCTCGGCCTCTACTGCGAGCTGCGTGGACGACTCAATTTCTTTGCTCGTGTGCTTCTG
 
. : . : . : . : . : . :
JMFS062F01+ CCAAAAGCACAGGTTTCAACTTGCAGGTGTGAAATGACCGGAGTATCCCCCGCTTCTCTG
                      ____________________________________________________________
consensus CCAAAAGCACAGGTTTCAACTTGCAGGTGTGAAATGACCGGAGTATCCCCCGCTTCTCTG