Previous Contig 003376:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001O22Sequence490003694 (11)pir|H71447|H714479e-28trehalose-6-phosphate synthase homolog DL4920W - Arabidopsis thaliana>gb:ATCHRIV221003376 (7)gb:A67842_14502874e-20Sequence 14 from Patent WO9742326.
JMFF010D02Sequence520003694 (11)pir|H71447|H714473e-44trehalose-6-phosphate synthase homolog DL4920W - Arabidopsis thaliana>gb:ATCHRIV704003376 (7)gb:BT005967_16388898e-83Arabidopsis thaliana At4g17770 gene, complete cds.>gb:AK118703_1816666 Arabidops
JMFF011B18Sequence539000577 (2)gb:BT005967_16388896e-88Arabidopsis thaliana At4g17770 gene, complete cds.>gb:AK118703_1816666 Arabidops779003376 (7)gb:BT005967_16388892e-95Arabidopsis thaliana At4g17770 gene, complete cds.>gb:AK118703_1816666 Arabidops
JMFF036C09Sequence579000577 (2)gb:BT005967_16388899e-94Arabidopsis thaliana At4g17770 gene, complete cds.>gb:AK118703_1816666 Arabidops696003376 (7)gb:BT005967_16388899e-87Arabidopsis thaliana At4g17770 gene, complete cds.>gb:AK118703_1816666 Arabidops
JMFS034F02Sequence625003376 (7)gb:BT005967_16388893e-94Arabidopsis thaliana At4g17770 gene, complete cds.>gb:AK118703_1816666 Arabidops
JMFS062C08Sequence501003376 (7)gb:BT005967_16388895e-35Arabidopsis thaliana At4g17770 gene, complete cds.>gb:AK118703_1816666 Arabidops
JMSF002O09Sequence233003694 (11)pir|H71447|H714471e-08trehalose-6-phosphate synthase homolog DL4920W - Arabidopsis thaliana>gb:ATCHRIV682003376 (7)gb:BT005967_16388895e-87Arabidopsis thaliana At4g17770 gene, complete cds.>gb:AK118703_1816666 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS034F02- GGGCTGCAGGCCGACCACGCCAAAAAAGAGCATGCTGGTGGTATCAG
                      ____________________________________________________________
consensus GGGCTGCAGGCCGACCACGCCAAAAAAGAGCATGCTGGTGGTATCAG
 
. : . : . : . : . : . :
JMFS034F02- AGTTCATCGGGTGCTCCCCGTCGCTTAGTGGTGCAATTAGAGTCAACCCGTGGAATATCG
                      ____________________________________________________________
consensus AGTTCATCGGGTGCTCCCCGTCGCTTAGTGGTGCAATTAGAGTCAACCCGTGGAATATCG
 
. : . : . : . : . : . :
JMFS034F02- ATGCAGTCGCTGAGGCAATGGATTCCGCTTTGGTTGTTTCCGAGCCCGAGAAACAGATGA
                      ____________________________________________________________
consensus ATGCAGTCGCTGAGGCAATGGATTCCGCTTTGGTTGTTTCCGAGCCCGAGAAACAGATGA
 
. : . : . : . : . : . :
JMFS034F02- GGCACGAGAAACATTACAAGTATGTGAGCACTCACGACGTCGCGTATTGGGCACATAGCT
                      ____________________________________________________________
consensus GGCACGAGAAACATTACAAGTATGTGAGCACTCACGACGTCGCGTATTGGGCACATAGCT
 
. : . : . : . : . : . :
JMFS034F02- TTATGCAGGACCTCGACCGAGCCTGCGGGGATCACGTGAAGAGAAGGTGTTGGGGTATCG
                      ____________________________________________________________
consensus TTATGCAGGACCTCGACCGAGCCTGCGGGGATCACGTGAAGAGAAGGTGTTGGGGTATCG
 
. : . : . : . : . : . :
JMFS034F02- GGTTTGGCTTAGGCTTTCGAGTAATCGCCTTGGACCCTAGCTTCAGGAAGCTATCGGTTG
                      ____________________________________________________________
consensus GGTTTGGCTTAGGCTTTCGAGTAATCGCCTTGGACCCTAGCTTCAGGAAGCTATCGGTTG
 
. : . : . : . : . : . :
JMFS034F02- AGCATATTGTGTCTGCTTACAAAAGGACCAAACACCGGGCAATTCTTTTGGACTACGATG
                      ____________________________________________________________
consensus AGCATATTGTGTCTGCTTACAAAAGGACCAAACACCGGGCAATTCTTTTGGACTACGATG
 
. : . : . : . : . : . :
JMFS034F02- GTGCTATGACACTCCCGAATTCTATCAGCAAGGGTCCCAATGACGAGGCTGTTGGTATCC
rJMFF011B18+ TCAGCAAGGGTCCCAATGACGAGGCTGTTGGTATCN
                      ____________________________________________________________
consensus GTGCTATGACACTCCCGAATTCTATCAGCAAGGGTCCCAATGACGAGGCTGTTGGTATCC
 
. : . : . : . : . : . :
JMFS034F02- TAAATAACTTGTGCAAGGATCCCAAGAACGTCGTTTTCCTCGTTAGT-GGAAAAGACAGA
rJMFF036C09+ AGT-GGAAAAGACAGA
rJMFF010D02+ CTCGTTAGT-GGAAAAGACAGA
rJMSF002O09+ CCCAAGAACGTCGTTTTCCTCGTTAGTGGGAAAAGACAGA
rJMFF011B18+ TAAATAACTTGTGCAAGGATCCCAAGAACGTCGTTTTCCTCGTTAGT-GGAAAAGACAGA
                      ____________________________________________________________
consensus TAAATAACTTGTGCAAGGATCCCAAGAACGTCGTTTTCCTCGTTAGT-GGAAAAGACAGA
 
. : . : . : . : . : . :
JMFS034F02- CAGACTTTAACT-CAATGGTTTTCCTCAAGTGAAAATTTGGGACTTGCAGCCGAGCATGG
rJMFF036C09+ CAGNCTTTAACT-CAATGGTTTTCCTCAAGTGAAAATTTGGGACTTGCAGCCGAGCATGG
rJMFF010D02+ CAGACTTTAACTCCAATGGTTTTCNTCAAGTGAAAATTTGGGACTTGCAGCCGAGCATGG
rJMSF002O09+ CAGACTTTAACT-CAATGGTTTTCCTCAAGTGAAAATTTGGGACTTGCAGCCGAGCATGG
rJMFF011B18+ CAGACTTTAACT-CAATGGTTTTCCTCAAGTGAAAATTTGGGACTTGCAGCCGAGCATGG
                      ____________________________________________________________
consensus CAGACTTTAACT-CAATGGTTTTCCTCAAGTGAAAATTTGGGACTTGCAGCCGAGCATGG
 
. : . : . : . : . : . :
JMFS034F02- ATATTTTGTTCGGCCAAGTCGGAATGCAGAATGGGAAACT
rJMFF036C09+ ATATTTTGTTCGGCCAAGTCGGAATGCAGAATGGGAAACTTCTATTGCGGTGCCAGATTT
rJMFF010D02+ ATATTTTGTTCGGCCAAGTCGGAATGCAGAATGGGAAACTTCTATTGCGGTGCCAGATTT
rJMSF002O09+ ATATTTTGTTCGGCCAAGTCGGAATGCAGAATGGGAAACTTCTATTGCGGTGCCAGATTT
rJMFF011B18+ ATATTTTGTTCGGCCAAGTCGGAATGCAGAATGGGAAACTTCTATTGCGGTGCCAGATTT
                      ____________________________________________________________
consensus ATATTTTGTTCGGCCAAGTCGGAATGCAGAATGGGAAACTTCTATTGCGGTGCCAGATTT
 
. : . : . : . : . : . :
rJMFF036C09+ CTACTGGAAGCAAATTGCTGAACCCGTAATGGGACTCTACACGGAGACAACTGATGGTTC
rJMFF010D02+ CTACTGGAAGCAAATTGCTGAACCCGTAATGGGACTCTACACGGAGACAACTGATGGTTC
rJMSF002O09+ CTACTGGAAGCAAATTGCTGAACCCGTAATGGGACTCTACACGGAGACAACTGATGGTTC
rJMFF011B18+ CTACTGGAAGCAAATTGCTGAACCCGTAATGGGACTCTACACGGAGACAACTGATGGTTC
                      ____________________________________________________________
consensus CTACTGGAAGCAAATTGCTGAACCCGTAATGGGACTCTACACGGAGACAACTGATGGTTC
 
. : . : . : . : . : . :
rJMFF036C09+ TTTTATCGAGACCAAGGACAGTGCCCTCGTTTGGAATTACCAATATGCAGATCGGGATTT
rJMFF010D02+ TTTTATCGAGACCAAGGACAGTGCCCTCGTTTGGAATTACCAATATGCAGATCGGGATTT
rJMSF002O09+ TTTTATCGAGACCAAGGACAGTGCCCTCGTTTGGAATTACCAATATGCAGATCGGGATTT
rJMFF011B18+ TTTTATCGAGACCAAGGACAGTGCCCTCGTTTGGAATTACCAATATGCAGATCGGGATTT
                      ____________________________________________________________
consensus TTTTATCGAGACCAAGGACAGTGCCCTCGTTTGGAATTACCAATATGCAGATCGGGATTT
 
. : . : . : . : . : . :
rJMFF036C09+ TGGGTCGTGTCAAGCCAAGGAGCTCCAAGATCACCTCGAAAGTGTTCTTGCTAACGAGCC
rJMFF001O22+ CC
rJMFF010D02+ TGGGTCGTGTCAAGCCAAGGAGCTCCAAGATCACCTCGAAAGTGTTCTTGCTAACGAGCC
rJMSF002O09+ TGGGTCGTGTCAAGCCAAGGAGCTCCAAGATCACCTCGAAAGTGTTCTTGCTAACGAGCC
rJMFF011B18+ TGGGTCGTGTCAAGCCAAGGAGCTCCAAGATCACCTCGAAAGTGTTCTTGCTAACGAGCC
                      ____________________________________________________________
consensus TGGGTCGTGTCAAGCCAAGGAGCTCCAAGATCACCTCGAAAGTGTTCTTGCTAACGAGCC
 
. : . : . : . : . : . :
rJMFF036C09+ TGTTTCTGTCAAGAGTGGCCCGCTTATTGTCGAGGTTAAGCCTCAGGGCGTGAACAAAGG
rJMFF001O22+ TGTTTCTGTCAAGAGTGGCCCGCTTATTGTCGAGGTTAAGCCTCAGGGCGTGAACAAAGG
rJMFF010D02+ TGTTTCTGTCAAGAGTGGCCCGCTTATTGTCGAGGTTAAGCCTCAGGGCGTGAACAAAGG
rJMSF002O09+ TGTTTCTGTCAAGAGTGGCCCGCTTATTGTCGAGGTTAAGCCTCAGGGCGTGAACAAAGG
rJMFF011B18+ TGTTTCTGTCAAGAGTGGCCCGCTTATTGTCGAGGTTAAGCCTCAGGGCGTGAACAAAGG
JMFS062C08+ GTCGAGGTTAAGCCTCAGGGCGTGAACAAAGG
                      ____________________________________________________________
consensus TGTTTCTGTCAAGAGTGGCCCGCTTATTGTCGAGGTTAAGCCTCAGGGCGTGAACAAAGG
 
. : . : . : . : . : . :
rJMFF036C09+ TCTCGTGGCAGAACGACTGCTAGCGATGATGAAGCAGAAGGATATGGTGCCCGATTTCGT
rJMFF001O22+ TCTCGTGGCAGAACGAGTGCTAGNGATGANGAAGCAGAAGGATATGGTGCCCGATTTCGT
rJMFF010D02+ TCTCGTGGCAGAACGACTGCTAGCGATGATGAAGCAGAAGGATATGGTGCCCGATTTCGT
rJMSF002O09+ TCTCGTGGCAGAACGACTGCTAGCGATGATGAAGCAGAAGGATATGGTGCCCGATTTCGT
rJMFF011B18+ TCTCGTGGCAGAACGACTGCTAGCGATGATGAAGCAGAAGGATATGGTGCCCGATTTCGT
JMFS062C08+ TCTCGTGGCAGAACGACTGCTAGCGATGATGAAGCAGAAGGATATGGTGCCCGATTTCGT
                      ____________________________________________________________
consensus TCTCGTGGCAGAACGACTGCTAGCGATGATGAAGCAGAAGGATATGGTGCCCGATTTCGT
 
. : . : . : . : . : . :
rJMFF036C09+ GCTGTGCATCGGGGATGACAGGTCAGACGAGGATATATTCGAGGTGATAATGAGTGCGGT
rJMFF001O22+ GCTGTGCATCGGGGATGACAGGTCAGANGAGGATATATTTGAGGTGATAATGAGNGCGGT
rJMFF010D02+ GCTGTGCATCGGGGATGACAGGTCAGACGAGGATATATTCGAGGTGATAATGAGTGCGGT
rJMSF002O09+ GCTGTGCATCGGGGATGACAGGTCAGACGAGGATATATTCGAGGTGATAATGAGTGCGGT
rJMFF011B18+ GCTGTGCATCGGGGATGACAGGTCAGACGAGGATATATTCGAGGTGATAATGAGTGCGGT
JMFS062C08+ GCTGTGCATCGGGGATGACAGGTCAGACGAGGATATATTCGAGGTGATAATGAGTGCGGT
                      ____________________________________________________________
consensus GCTGTGCATCGGGGATGACAGGTCAGACGAGGATATATTCGAGGTGATAATGAGTGCGGT
 
. : . : . : . : . : . :
rJMFF036C09+ GGCTCAAGAATCGCTGTCCCCGGTTGCTGAAGTGTTCGCTTGCACAGTCGGGCAGAAGCC
rJMFF001O22+ GGCTCAAGAATCGNNGTCCCCGGTTGCTGAAGTGTT
rJMFF010D02+ GGCTCAAGAATCGCTGTCCCCGGTTGCTGAAGTGTTCGCTTGCACAGTCGGGCAGAAGCC
rJMSF002O09+ GGCTCAAGAATCGCTGTCCCCGGTTGCTGAAGTGTTCGCTTGCACAGTCGGGCAGAAGCC
rJMFF011B18+ GGCTCAAGAATCGCTGTCCCCGGTTGCTGAAGTGTTCGCTTGCACAGTCGGGCAGAAGCC
JMFS062C08+ GGCTCAAGAATCGCTGTCCCCGGTTGCTGAAGTGTTCGCTTGCACAGTCGGGCAGAAGCC
                      ____________________________________________________________
consensus GGCTCAAGAATCGCTGTCCCCGGTTGCTGAAGTGTTCGCTTGCACAGTCGGGCAGAAGCC
 
. : . : . : . : . : . :
rJMFF036C09+ CAGCAAGGCGAAGTATTACCTCGACGACACCTCTGAGATCCTGAGGATGTTGCAGGGCCT
rJMFF010D02+ CAGCAAGGCGAAGTATTACCTCGACGACACCTCTGAGATCCTGAGGATGTTGCAGGGCCT
rJMSF002O09+ CAGCAAGGCGAAGTATTACCTCGACGACACCTCTGAGATCCTGAGGATGTTGCAGGGCCT
rJMFF011B18+ CAGCAAGGCGAAGTATTACCTCGACGACACCTCTGAGATCCTGAGGATGTTGCAGGGCCT
JMFS062C08+ CAGCAAGGCGAAGTATTACCTCGACGACACCTCTGAGATCCTGAGGATGTTGCAGGGCCT
                      ____________________________________________________________
consensus CAGCAAGGCGAAGTATTACCTCGACGACACCTCTGAGATCCTGAGGATGTTGCAGGGCCT
 
. : . : . : . : . : . :
rJMFF036C09+ CGCGACTGCTTCTGAGCAATCTGCTCGACCCACTCCCCGCTCTTCTCAGCAGGTTATCAT
rJMFF010D02+ CGCGACTGCTTCTGAGCAATCTGCTCGACCCACTCCCCGCTCTTCTCAGCAGGTTATCAT
rJMSF002O09+ CGCGACTGCTTCTGAGCAATCTGCTCGACCCACTCCCCGCTCT
rJMFF011B18+ CGCGACTGCTTCTGAGCAATCTGCTCGACCCACTCCCCGCTCTTCTCAGCAGGTTATCAT
JMFS062C08+ CGCGACTGCTTCTGAGCAATCTGCTCGACCCACTCCCCGCTCTTCTCAGCAGGTTATCAT
                      ____________________________________________________________
consensus CGCGACTGCTTCTGAGCAATCTGCTCGACCCACTCCCCGCTCTTCTCAGCAGGTTATCAT
 
. : . : . : . : . : . :
rJMFF036C09+ TGACAGAGAATAGCGCCCGAGA
rJMFF010D02+ TGACAGAGAATAGCGCCCGAGA
rJMFF011B18+ TGACAGAGAATAGCGCCCGAGA
JMFS062C08+ TGACAGAGAATAGCGCCCGAGAAATTAAAGAACAGAAAAAAAAAAAAAAAAAACTCGAGA
                      ____________________________________________________________
consensus TGACAGAGAATAGCGCCCGAGAAATTAAAGAACAGAAAAAAAAAAAAAAAAAACTCGAGA