Previous Contig 003372:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002D15Sequence320003372 (6)765011025 (6)gb:AY500156_16096482e-40Lycopersicon esculentum MAP3Ka mRNA, complete cds.
JMFF014J08Sequence541003372 (6)gb:AY500156_16096486e-17Lycopersicon esculentum MAP3Ka mRNA, complete cds.642011025 (6)gb:AY500156_16096481e-31Lycopersicon esculentum MAP3Ka mRNA, complete cds.
JMFF017L02Sequence531003372 (6)gb:AY500156_16096480.006Lycopersicon esculentum MAP3Ka mRNA, complete cds.701011025 (6)gb:AY500156_16096482e-35Lycopersicon esculentum MAP3Ka mRNA, complete cds.
JMFF025C23Sequence578003372 (6)gb:AY500156_16096484e-15Lycopersicon esculentum MAP3Ka mRNA, complete cds.614011025 (6)gb:AY500156_16096484e-24Lycopersicon esculentum MAP3Ka mRNA, complete cds.
JMFF050M19Sequence575003372 (6)gb:AY500156_16096486e-17Lycopersicon esculentum MAP3Ka mRNA, complete cds.604011025 (6)gb:AY500156_16096482e-26Lycopersicon esculentum MAP3Ka mRNA, complete cds.
JMFS061E08Sequence600003372 (6)gb:AY500156_16096482e-12Lycopersicon esculentum MAP3Ka mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF050M19+ CTCT
                      ____________________________________________________________
consensus CTCT
 
. : . : . : . : . : . :
JMFF014J08+ GAGAATCCAAACTACCACCCACAAATCGAGGATGTAG
JMFF050M19+ GNGCATCATCCAACTTCNCCGTGGAGAATCCAAACTACCACCCACAAATCGAGGATGTAG
JMFF025C23+ AATCGAGGATGTAG
                      ____________________________________________________________
consensus GNGCATCATCCAACTTCNCCGTGGAGAATCCAAACTACCACCCACAAATCGAGGATGTAG
 
. : . : . : . : . : . :
JMFF014J08+ AGGTGACGGTGTGGTAGTAGGTGCTCTCGATCTAACAGGGCTTCGAGATAGCGGGCTCAT
JMFF050M19+ AGGTGACGGTGTGGTAGTAGGTGCTCTCGATCTAACAGGGCTTCGAGATAGCGGGCTCAT
JMFF025C23+ AGGTGACGGTGTGGTAGTAGGTGCTCTCGATCTAACAGGGCTTCGAGATAGCGGGCTCAT
JMFS061E08+ AGGTGACGGTGTGGTAGTAGGTGCTCTCGATCTAACAGGGCTTCGAGATAGCGGGCTCAT
                      ____________________________________________________________
consensus AGGTGACGGTGTGGTAGTAGGTGCTCTCGATCTAACAGGGCTTCGAGATAGCGGGCTCAT
 
. : . : . : . : . : . :
JMFF014J08+ CCTGTTGTCCCCAGCTCCTCTGAAAGAAGACGGTTGAGCATGATCGGGGTGGGGATGATC
JMFF050M19+ CCTGTTGTCCCCAGCTCCTCTGAAAGAAGACGGTTGAGCATGATCGGGGTGGGGATGATC
JMFF025C23+ CCTGTTGTCCCCAGCTCCTCTGAAAGAAGACGGTTGAGCATGATCGGGGTGGGGATGATC
JMFF017L02+ GTTGTCCCCAGCTCCTCTGAAAGAAGACGGTTGAGCATGATCGGGGTGGGGATGATC
JMFS061E08+ CCTGTTGTCCCCAGCTCCTCTGAAAGAAGACGGTTGAGCATGATCGGGGTGGGGATGATC
                      ____________________________________________________________
consensus CCTGTTGTCCCCAGCTCCTCTGAAAGAAGACGGTTGAGCATGATCGGGGTGGGGATGATC
 
. : . : . : . : . : . :
JMFF014J08+ ATCATAGGAGCCAGTAGAGCTAACGCTGGATCCCGACTCCGACCCAGATCCCAATCCAAT
JMFF050M19+ ATCATAGGAGCCAGTAGAGCTAACGCTGGATCCCGACTCCGACCCAGATCCCAATCCAAT
JMFF025C23+ ATCATAGGAGCCAGTAGAGCTAACGCTGGATCCCGACTCCGACCCAGATCCCAATCCAAT
JMFF017L02+ ATCATAGGAGCCAGTAGAGCTAACGCTGGATCCCGACTCCGACCCAGATCCCAATCCAAT
JMFS061E08+ ATCATAGGAGCCAGTAGAGCTAACGCTGGATCCCGACTCCGACCCAGATCCCAATCCAAT
                      ____________________________________________________________
consensus ATCATAGGAGCCAGTAGAGCTAACGCTGGATCCCGACTCCGACCCAGATCCCAATCCAAT
 
. : . : . : . : . : . :
JMFF014J08+ CCCATGTTCATTCGACGGCGTCGGCAGTGGAAGCGGTTTATCAGACGAAGCCGAATCGAA
JMFF050M19+ CCCATGTTCATTCGACGGCGTCGGCAGTGGAAGCGGTTTATCAGACGAAGCCGAATCGAA
JMFF002D15+ GACGGCGTCGGCAGTGGAAGCGGTTTATCAGACGAAGCCGAATCGAA
JMFF025C23+ CCCATGTTCATTCGACGGCGTCGGCAGTGGAAGCGGTTTATCAGACGAAGCCGAATCGAA
JMFF017L02+ CCCATGTTCATTCGACGGCGTCGGCAGTGGAAACGGTTTATCAGACGAAGCCGAATCGAA
JMFS061E08+ CCCATGTTCATTCGACGGCGTCGGCAGTGGAAGCGGTTTATCAGACGAAGCCGAATCGAA
                      ____________________________________________________________
consensus CCCATGTTCATTCGACGGCGTCGGCAGTGGAAGCGGTTTATCAGACGAAGCCGAATCGAA
 
. : . : . : . : . : . :
JMFF014J08+ ACCCGAGAACCCCGAAGACCCTCTACCACTAGAGAATTCTCTGCTACTTCTGGGCGAATT
JMFF050M19+ ACCCGAGAACCCCGAAGACCCTCTACCACTAGAGAATTCTCTGCTACTTCTGGGCGAATT
JMFF002D15+ ACCCGAGAACCCCGAAGACCCTCTACCACTAGAGAATTCTCTGCTACTTCTGGGCGAATT
JMFF025C23+ ACCCGAGAACCCCGAAGACCCTCTACCACTAGAGAATTCTCTGCTACTTCTGGGCGAATT
JMFF017L02+ ACCCGAGAACCCCGAAGACCCTCTACCACTAGAGAATTCTCTGCTACTTCTGGGCGAATT
JMFS061E08+ ACCCGAGAACCCCGAAGACCCTCTACCACTAGAGAATTCTCTGCTACTTCTGGGCGAATT
                      ____________________________________________________________
consensus ACCCGAGAACCCCGAAGACCCTCTACCACTAGAGAATTCTCTGCTACTTCTGGGCGAATT
 
. : . : . : . : . : . :
JMFF014J08+ CCTCGCTATAACTGTTCCGAACGACTCATCGAAGCTCTTGGGCCTGTCGCTCCTATCAAC
JMFF050M19+ CCTCGCTATAACTGTTCCGAACGACTCATCGAAGCTCTTGGGCCTGTCGCTCCTATCAAC
JMFF002D15+ CCTCGCTATAACTGTTCCGAACGACTCATCGAAGCT-ATGGGCCTGTCGCTCCTATCAAC
JMFF025C23+ CCTCGCTATAACTGTTCCGAACGACTCATCGAAGCTCTTGGGCCTGTCGCTCCTATCAAC
JMFF017L02+ CCTCGCTATAACTGTTCCGAACGACTCATCGAAGCTCTTGGGCCTGTCGCTCCTATCAAC
JMFS061E08+ CCTCGCTATAACTGTTCCGAACGACTCATCGAAGCTCTTGGGCCTGTCGCTCCTATCAAC
                      ____________________________________________________________
consensus CCTCGCTATAACTGTTCCGAACGACTCATCGAAGCTCTTGGGCCTGTCGCTCCTATCAAC
 
. : . : . : . : . : . :
JMFF014J08+ GGCGGCGGCGGCTCTCCGGCTTTCATTCTTGACGCTGGCCGGAGAATTGGGCTGTGGGTC
JMFF050M19+ GGCGGCGGCGGCTCTCCGGCTTTCATTCTTGACGCTGGCCGGAGAATTGGGCTGTGGGTC
JMFF002D15+ GGCGGCGGCGGCTCTCCGGCTTTCATTCTTGACGCTGGCCGGAGAATTGGGCTGTGGGTC
JMFF025C23+ GGCGGCGGCGGCTCTCCGGCTTTCATTCTTGACGCTGGCCGGAGAATTGGGCTGTGGGTC
JMFF017L02+ GGCGGCGGCGGCTCTCCGGCTTTCATTCTTGACGCTGGCCGGAGAATTGGGCTGTGGGTC
JMFS061E08+ GGCGGCGGCGGCTCTCCGGCTTTCATTCTTGACGCTGGCCGGAGAATTGGGCTGTGGGTC
                      ____________________________________________________________
consensus GGCGGCGGCGGCTCTCCGGCTTTCATTCTTGACGCTGGCCGGAGAATTGGGCTGTGGGTC
 
. : . : . : . : . : . :
JMFF014J08+ TTTGGAGCTACTCTTGGTGGATTTCCTTCCCCACCAAGCGGGCATTTTTTATGAACTAAC
JMFF050M19+ TTTGGAGCTACTCTTGGTGGATTTCCTTCCCCACCAAGCGGGCATTTTTTATGAACTAAC
JMFF002D15+ TTTGGAGCTACTCTTGGTGGATTTCCTTCCCCACCAAGCGGGCATTTTTTATGAACTAAC
JMFF025C23+ TTTGGAGCTACTCTTGGTGGATTTCCTTCCCCACCAAGCGGGCATTTTTTATGAACTAAC
JMFF017L02+ TTTGGAGCTACTCTTGGTGGATTTCCTTCCCCACCAAGCGGGCATTTTTTATGAACTAAC
JMFS061E08+ TTTGGAGCTACTCTTGGTGGATTTCCTTCCCCACCAAGCGGGCATTTTTTATGAACTAAC
                      ____________________________________________________________
consensus TTTGGAGCTACTCTTGGTGGATTTCCTTCCCCACCAAGCGGGCATTTTTTATGAACTAAC
 
. : . : . : . : . : . :
JMFF050M19+ TGAGAGAAGAATGAGTGAAAAACTTATCAGT
JMFF002D15+ TGAGAGAAGAATGAGTGAAAAACTTATCAGTTTC
JMFF025C23+ TGAGAGAAGAATGAGTGAAAAACTTATCAGTTTCTGAGAGAGAGAGAGGAGGAGGAGGAG
JMFF017L02+ TGAGAGAAGAATGAGTGAAAAACTTATCAGTTTCTGAGAGAGAGAGAGGAGGAGGAGGAG
JMFS061E08+ TGAGAGAAGAATGAGTGAAAAACTTATCAGTTTCTGAGAGAGAGAGAGGAGGAGGAGGAG
                      ____________________________________________________________
consensus TGAGAGAAGAATGAGTGAAAAACTTATCAGTTTCTGAGAGAGAGAGAGGAGGAGGAGGAG
 
. : . : . : . : . : . :
JMFF025C23+ AAATTTTATATTATGAACGGAAA
JMFF017L02+ AAATTTTATATTATGAACGGAAATGAGGTAAAGGGGGATGTACCAGAAGGA
JMFS061E08+ AAATTTTATATTATGAACGGAAATGAGGTAAAGGGGGATGTACCAGAAGGACCTGAAGAC
                      ____________________________________________________________
consensus AAATTTTATATTATGAACGGAAATGAGGTAAAGGGGGATGTACCAGAAGGACCTGAAGAC