Previous Contig 003368:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010J22Sequence563003368 (25)pir|A84649|A846492e-23probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g727010459 (28)pir|A84649|A846492e-35probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFF021M09Sequence570003368 (25)pir|A84649|A846492e-23probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g593010459 (28)pir|A84649|A846498e-16probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFF037K12Sequence587003368 (25)pir|A84649|A846492e-23probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFF042I04Sequence653003368 (25)pir|A84649|A846492e-23probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g593010459 (28)pir|A84649|A846496e-19probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFF044M02Sequence648003368 (25)pir|T08604|T086042e-59hypothetical protein GRR1 - soybean>gb:AF019910_1761610 Glycine max grr1 (grr1) 599010459 (28)pir|A84649|A846493e-15probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFF046M11Sequence649003368 (25)pir|A84649|A846497e-19probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g446010459 (28)pir|A84649|A846490.003probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFF048M07Sequence447003368 (25)pir|A84649|A846493e-12probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g360010459 (28)
JMFS036A03Sequence568003368 (25)pir|A84649|A846492e-23probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFS048B07Sequence293003368 (25)
JMFS060H08Sequence622003368 (25)pir|A84649|A846493e-15probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFS064G11Sequence557003368 (25)pir|A84649|A846491e-22probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFS068C04Sequence612003368 (25)pir|A84649|A846492e-23probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFS077H03Sequence645003368 (25)pir|A84649|A846491e-22probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFS092D08Sequence611003368 (25)pir|A84649|A846492e-23probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFS108H09Sequence618003368 (25)pir|A84649|A846492e-23probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFS112G01Sequence617003368 (25)pir|A84649|A846492e-23probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFS112H08Sequence614003368 (25)pir|A84649|A846492e-23probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFS117A09Sequence567003368 (25)pir|A84649|A846493e-22probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMFS155C12Sequence577003368 (25)pir|A84649|A846492e-23probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMSF005A17Sequence244003368 (25)
JMSF008O23Sequence304003368 (25)730010459 (28)gb:AY485830_16085075e-37Arabidopsis thaliana EIN3-binding F-box protein 2 (EBF2) mRNA, complete cds.>gb:
JMSF013P19Sequence267003368 (25)
JMSF033P11Sequence619003368 (25)pir|A84649|A846492e-23probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g724010459 (28)pir|A84649|A846492e-35probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMSF037P20Sequence622003368 (25)pir|A84649|A846492e-23probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g719010459 (28)pir|A84649|A846492e-35probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g
JMSF046L15Sequence473003368 (25)pir|A84649|A846494e-05probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g628010459 (28)pir|A84649|A846491e-24probable glucose regulated repressor protein [imported] - Arabidopsis thaliana>g

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF044M02+ TAGTTACCGAAGCGAGATTGGGGCAGCTTTTTGCAATGGCCATCAACGATTTATC
                      ____________________________________________________________
consensus TAGTTACCGAAGCGAGATTGGGGCAGCTTTTTGCAATGGCCATCAACGATTTATC
 
. : . : . : . : . : . :
JMFF044M02+ AGTAATTCCCGGGCATTGGCAAAGGTCGAGCTTCTCTAGCTGATGGCACCCACTTGCAAT
                      ____________________________________________________________
consensus AGTAATTCCCGGGCATTGGCAAAGGTCGAGCTTCTCTAGCTGATGGCACCCACTTGCAAT
 
. : . : . : . : . : . :
JMFF044M02+ CTCGAATAAACCTTCATCACTTATGGATGAAATGTTCCAGAGAGAAAGAGCCCTGAGAGA
                      ____________________________________________________________
consensus CTCGAATAAACCTTCATCACTTATGGATGAAATGTTCCAGAGAGAAAGAGCCCTGAGAGA
 
. : . : . : . : . : . :
JMFF044M02+ AGGACAGCCTCGACCAATTGCCTTGAGGCCAGAATCGGTCACACCACGGAAGGAGTTGTT
                      ____________________________________________________________
consensus AGGACAGCCTCGACCAATTGCCTTGAGGCCAGAATCGGTCACACCACGGAAGGAGTTGTT
 
. : . : . : . : . : . :
JMFF044M02+ TCCTCTAATAGATAGCTTCCCCAATCCTCCCCGCCTTGCAGTTCCAACAGCAATAGCAGC
                      ____________________________________________________________
consensus TCCTCTAATAGATAGCTTCCCCAATCCTCCCCGCCTTGCAGTTCCAACAGCAATAGCAGC
 
. : . : . : . : . : . :
JMFF044M02+ AAGTCTGACATCTGTAGCCTTCTTCCCATCAAGGCACCTGGAAAGAAATCCATCGCCTTC
                      ____________________________________________________________
consensus AAGTCTGACATCTGTAGCCTTCTTCCCATCAAGGCACCTGGAAAGAAATCCATCGCCTTC
 
. : . : . : . : . : . :
JMFF044M02+ CTCGTTATCTTGAACTTCAGAAACATTAGATTGAACAAACCCGTCCTTCTTATCAGACTT
JMFF046M11+ CAAACCCGTCCTTCTTATCAGACTG
JMFS077H03+ ATCAGACTT
                      ____________________________________________________________
consensus CTCGTTATCTTGAACTTCAGAAACATTAGATTGAACAAACCCGTCCTTCTTATCAGACTT
 
. : . : . : . : . : . :
JMFF044M02+ GATGAGCTCAGGTTGCATAGCGGTGGCATTGTCCCCTTCCTCGGGCTCTGAAGCCTCACC
JMFF046M11+ NATGAGCTCAGGTTGCATAGCGGTGGCATTGTCCCCTTCCTCGGGCTCTGAAGCCTCACC
JMFS077H03+ GATGAGCTCAGGGTGCATAGCGGTGGCATTGTCCCCTTCCTCGGGCTCTGAAGCCTCACC
JMFS108H09+ GGCATTGTCCCCTTCCTCGGGCTCTGAAGCCTCACC
JMSF033P11+ GCTCTGAAGCCTCACC
JMFS112G01+ GTCCCCTTCCTCGGGCTCTGAAGCCTCACC
JMFS092D08+ GCATTGTCCCCTTCCTCGGGCTCTGAAGCCTCACC
JMFS068C04+ GCATTGTCCCCTTCCTCGGGCTCTGAAGCCTCACC
JMFS112H08+ CCCCTTCCTCGGGCTCTGAAGCCTCACC
JMFS155C12+ C
JMFS036A03+ C
JMFF021M09+ CTCACC
JMFF042I04+ TGCATAGCGGTGGCATTGTCCCCTTCCTCGGGCTCTGAAGCCTCACC
JMSF037P20+ TGAAGCCTCACC
                      ____________________________________________________________
consensus GATGAGCTCAGGTTGCATAGCGGTGGCATTGTCCCCTTCCTCGGGCTCTGAAGCCTCACC
 
. : . : . : . : . : . :
JMFF044M02+ GCTTTTGATGGTTGAGAGTTCATCTCTGCAGATTGTACTTAAAAGCATAAGCCACCGCTT
JMFF046M11+ GCTTTTGATGGTTGAGAGTTCATCTCTGCAGATTGTACTTAAAAGCATAAGCCACCGC-T
JMFS077H03+ GCTTTTGATGGTTGAGAGTTCATCTCTGCAGATTGTACTTAACTGCATAAGCCACCGCTT
JMFS108H09+ GCTTTTGATGGTTGAGAGTTCATCTCTGCAGATTGTACTTAAAAGCATAAGCCACCGCTT
JMSF033P11+ GCTTTTGATGGTTGAGAGTTCATCTCTGCAGATTGTACTTAAAAGCATAAGCCACCGCTT
JMFS112G01+ GCTTTGGATGGTTGAGAGTTCATCTCTGCAGATTGTACTTAAAAGCATAAGCCACCGCTT
JMFS092D08+ GCTTTTGATGGTTGAGAGTTCATCTCTGCAGATTGTACTTAAAAGCATAAGCCACCGCTT
JMFS068C04+ GCTTTTGATGGTTGAGAGTTCATATCTGCAGATTGTACTTAAAAGCATAAGCCACCGCTT
JMFS112H08+ GCTTTTGATGGTTGAGAGTTCATCTCTGCAGATTGTACTTAAAAGCATAAGCCACCGCTT
JMFF037K12+ ATGGTTGAGAGTTCATCTCTGCAGATTGTACTTAAAAGCATAAGCCACCGCTT
JMFS155C12+ GCTTTTGATGGTTGAGAGTTCATCTCTGCAGATTGTACTTAAAAGCATAAGCCACCGCTT
JMFS036A03+ GCTTTTGATGGTTGAGAGTTCATCTCTGCAGATTGTACTTAAAAGCATAAGCCACCGCTT
JMFF021M09+ GCTTTTGATGGTTGAGAGTTCATCTCTGCAGATTGTACTTAAAAGCATAAGCCACCGCTT
JMFF010J22+ TTTTGATGGTTGAGAGTTCATCTCTGCAGATTGTACTTAAAAGCATAAGCCACCGCTT
JMFS117A09+ CATCTCTGCAGATTGTACTTAAAAGCATAAGCCACCGCTT
JMFS064G11+ CATCTCTGCAGATTGTACTTAAAAGCATAAGCCACCGCTT
JMFF042I04+ GCTTTTGATGGTTGAGAGTTCATCTCTGCAGATTGTACTTAAAAGCATAAGCCACCGCTT
JMSF037P20+ GCTTTTGATGGTTGAGAGTTCATCTCTGCAGATTGTACTTAAAAGCATAAGCCACCGCTT
                      ____________________________________________________________
consensus GCTTTTGATGGTTGAGAGTTCATCTCTGCAGATTGTACTTAAAAGCATAAGCCACCGCTT
 
. : . : . : . : . : . :
JMFF044M02+ GGAAACACCAGCACAGGCACTCCTCTCCTGCCCTCCAACCGGAAGACGTCTGAAAATCTC
JMFF046M11+ GGAAACACCAGCACAGGCACTCCTCTCCTGCCCTCCAACCGGAAGACGTCTGAAAATCTC
JMFS077H03+ GGAAACACCAGCACAGGCACTCCTCTCCTGCCCTCCAACCGGAAGACGTCTGAAAATCTC
JMFS108H09+ GGAAACACCAGCACAGGCACTCCTCTCCTGCCCTCCAACCGGAAGACGTCTGAAAATCTC
JMSF033P11+ GGAAACACCAGCACAGGCACTCCTCTCCTGCCCTCCAACCGGAAGACGTCTGAAAATCTC
JMFS112G01+ GGAAACACCAGCACAGGCACTCCTCTCCTGCCCTCCAACCGGAAGACGTCTGAAAATCTC
JMFS092D08+ GGAAACACCAGCACAGGCACTCCTCTCCTGCCCTCCAACCGGAAGACGTCTGAAAATCTC
JMFS068C04+ GGAAACACCAGCACAGGCACTCCTCTCCTGCCCTCCAACCGGAAGACGTCTGAAAATCTC
JMFS112H08+ GGAAACACCAGCACAGGCACTCCTCTCCTGCCCTCCAACCGGAAGACGTCTGAAAATCTC
JMFF037K12+ GGAAACACCAGCACAGGCACTCCTCTCCTGCCCTCCAACCGGAAGACGTCTGAAAATCTC
JMFS155C12+ GGAAACACCAGCACAGGCACTCCTCTCCTGCCCTCCAACCGGAAGACGTCTGAAAATCTC
JMFS036A03+ GGAAACACCAGCACAGGCACTCCTCTCCTGCCCTCCAACCGGAAGACGTCTGAAAATCTC
JMFF021M09+ GGAAACACCAGCACAGGCACTCCTCTCCTGCCCTCCAACCGGAAGACGTCTGAAAATCTC
JMFF048M07+ TC
JMFF010J22+ GGAAACACCAGCACAGGCACTCCTCTCCTGCCCTCCAACCGGAAGACGTCTGAAAATCTC
JMFS117A09+ GGAAACACCAGCACAGGCACTCCTCTCCTGCCCTCCAACCGGAAGACGTCTGAAAATCTC
JMFS064G11+ GGAAACACCAGCACAGGCACTCCTCTCCTGCCCTCCAACCGGAAGACGTCTGAAAATCTC
JMFF042I04+ GGAAACACCAGCACAGGCACTCCTCTCCTGCCCTCCAACCGGAAGACGTCTGAAAATCTC
JMSF037P20+ GGAAACACCAGCACAGGCACTCCTCTCCTGCCCTCCAACCGGAAGACGTCTGAAAATCTC
JMFS060H08+ CAACCGGAAGACGTCTGAAAATCTC
                      ____________________________________________________________
consensus GGAAACACCAGCACAGGCACTCCTCTCCTGCCCTCCAACCGGAAGACGTCTGAAAATCTC
 
. : . : . : . : . : . :
JMFF044M02+ AAAGAGACATTCATCGGGGAGGAGTTCAATCGAAGGCTGTTTCTTCTCG
JMFF046M11+ AAAGAGACATTCATCGGGGAGGACTTCAATCGAAGCCTGTTTCTTCTCGTCGACTTTTTC
JMFS077H03+ AAAGAGACATTCATCGGGGAGGACTTCAATCGAAGCCTGTTTCTTCTCGTCGACTTTTTC
JMFS108H09+ AAAGAGACATTCATCGGGGAGGACTTCAATCGAAGCCTGTTTCTTCTCGTCGACTTTTTC
JMSF033P11+ AAAGAGACATTCATCGGGGAGGACTTCAATCGAAGCCTGTTTCTTCTCGTCGACTTTTTC
JMFS112G01+ AAAGAGACATTCATCGGGGAGGACTTCAATCGAAGCCTGTTTCTTCTCGTCGACTTTTTC
JMFS092D08+ AAAGAGACATTCATCGGGGAGGACTTCAATCGAAGCCTGTTTCTTCTCGTCGACTTTTTC
JMFS068C04+ AAAGAGACATTCATCGGGGAGGACTTCAATCGAAGCCTGTTTCTTCTCGTCGACTTTTTC
JMFS112H08+ AAAGAGACATTCATCGGGGAGGACTTCAATCGAAGCCTGTTTCTTCTCGTCGACTTTTTC
JMFF037K12+ AAAGAGACATTCATCGGGGAGGACTTCAATCGAAGCCTGTTTCTTCTCGTCGACTTTTTC
JMFS155C12+ AAAGAGACATTCATCGGGGAGGACTTCAATCGAAGCCTGTTTCTTCTCGTCGACTTTTTC
JMFS036A03+ AAAGAGACATTCATCGGGGAGGACTTCAATCGAAGCCTGTTTCTTCTCGTCGACTTTTTC
JMFF021M09+ AAAGAGACATTCATCGGGGAGGACTTCAATCGAAGCCTGTTTCTTCTCGTCGACTTTTTC
JMFF048M07+ AAAGAGACATTCATCGGGGAGGACTTCAATCGAAGCCTGTTTCTTCTCGTCGACTTTTTC
JMFF010J22+ AAAGAGACATTCATCGGGGAGGACTTCAATCGAAGCCTGTTTCTTCTCGTCGACTTTTTC
JMFS117A09+ AAAGAGACATTCATCGGGGAGGACTTCAATCGAAGCCTGTTTCTTCTCGTCGACTTTTTC
JMFS064G11+ AAAGAGACATTCATCGGGGAGGACTTCAATCGAAGCCTGTTTCTTCTGGTCGACTTTTTC
JMFF042I04+ AAAGAGACATTCATCGGGGAGGACTTCAATCGAAGCCTGTTTCTTCTCGTCGACTTTTTC
JMSF037P20+ AAAGAGACATTCATCGGGGAGGACTTCAATCGAAGCCTGTTTCTTCTCGTCGACTTTTTC
JMSF046L15+ GACTTTTTC
JMFS060H08+ AAAGAGACATTCATCGGGGAGGACTTCAATCGAAGCCTGTTTCTTCTCGTCGACTTTTTC
                      ____________________________________________________________
consensus AAAGAGACATTCATCGGGGAGGACTTCAATCGAAGCCTGTTTCTTCTCGTCGACTTTTTC
 
. : . : . : . : . : . :
JMFF046M11+ TCCACTAAATACAAAGGGAGCATTGATGCGAGACCTCTTGCGAGAAGGAAAATACACATC
JMFS077H03+ TCCACTAAATACAAAGGGAGCATTGATGCGAGACCTCTTGCGAGAAGGAAAATACACATC
JMFS108H09+ TCCACTAAATACAAAGGGAGCATTGATGCGAGACCTCTTGCGAGAAGGAAAATACACATC
JMSF033P11+ TCCACTAAATACAAAGGGAGCATTGATGCGAGACCTCTTGCGAGAAGGAAAATACACATC
JMFS112G01+ TCCACTAAATACAAAGGGAGCATTGATGCGAGACCTCTTGCGAGAAGGAAAATACACATC
JMFS092D08+ TCCACTAAATACAAAGGGAGCATTGATGCGAGACCTCTTGCGAGAAGGAAAATACACATC
JMFS068C04+ TCCACTAAATACAAAGGGAGCATTGATGCGAGACCTCTTGCGAGAAGGAAAATACACATC
JMFS112H08+ TCCACTAAATACAAAGGGAGCATTGATGCGAGACCTCTTGCGAGAAGGAAAATACACATC
JMFF037K12+ TCCACTAAATACAAAGGGAGCATTGATGCGAGACCTCTTGCGAGAAGGAAAATACACATC
JMFS155C12+ TCCACTAAATACAAAGGGAGCATTGATGCGAGACCTCTTGCGAGAAGGAAAATACACATC
JMFS036A03+ TCCACTAAATACAAAGGGAGCATTGATGCGAGACCTCTTGCGAGAAGGAAAATACACATC
JMFF021M09+ TCCACTAAATACAAAGGGAGCATTGATGCGAGACCTCTTGCGAGAAGGAAAATACACATC
JMFF048M07+ TCCACTAAATACAAAGGGAGCATTGATGCGAGACCTCTTGCGAGAAGGAAAATACACATC
JMFF010J22+ TCCACTAAATACAAAGGGAGCATTGATGCGAGACCTCTTGCGAGAAGGAAAATACACATC
JMFS117A09+ TCCACTAAATACAAAGGGAGCATTGATGCGAGACCTCTTGCGAGAAGGAAAATACACATC
JMFS064G11+ TCCACTAAATACAAAGGGAGCATTGATGCGAGACCTCTTGCGAGAAGGAAAATACACATC
JMFF042I04+ TCCACTAAATACAAAGGGAGCATTGATGCGAGACCTCTTGCGAGAAGGAAAATACACATC
JMSF037P20+ TCCACTAAATACAAAGGGAGCATTGATGCGAGACCTCTTGCGAGAAGGAAAATACACATC
JMSF046L15+ TCCACTAAATNCAAAGGGNGCNNTGATGCGAGACCTCTTGCGNGAAGGNAAATACACATC
JMFS060H08+ TCCACTAAATACAAAGGGAGCATTGATGCGAGACCTCTTGCGAGAAGGAAAATACACATC
                      ____________________________________________________________
consensus TCCACTAAATACAAAGGGAGCATTGATGCGAGACCTCTTGCGAGAAGGAAAATACACATC
 
. : . : . : . : . : . :
JMFF046M11+ CACTTGATGGCCAAGGGACAAAAAGAGAATTGAGTCCATGGGACTAGGGCAAAAATCATC
JMFS077H03+ CACTTGATGGCCAAGGGACAAAAAGAGAATTGAGTCCATGGGACTAGGGCAAAAATCATC
JMFS108H09+ CACTTGATGGCCAAGGGACAAAAAGAGAATTGAGTCCATGGGACTAGGGCAAAAATCATC
JMSF033P11+ CACTTGATGGCCAAGGGACAAAAAGAGAATTGAGTCCATGGGACTAGGGCAAAAATCATC
JMFS112G01+ CACTTGATGGCCAAGGGACAAAAAGAGAATTGAGTCCATGGGACTAGGGCAAAAATCATC
JMFS092D08+ CACTTGATGGCCAAGGGACAAAAAGAGAATTGAGTCCATGGGACTAGGGCAAAAATCATC
JMFS068C04+ CACTTGATGGCCAAGGGACAAAAAGAGAATTGAGTCCATGGGACTAGGGCAAAAATCATC
JMFS112H08+ CACTTGATGGCCAAGGGACAAAAAGAGAATTGAGTCCATGGGACTAGGGCAAAAATCATC
JMFS048B07+ CAAAAATCATC
JMFF037K12+ CACTTGATGGCCAAGGGACAAAAAGAGAATTGAGTCCATGGGACTAGGGCAAAAATCATC
JMFS155C12+ CACTTGATGGCCAAGGGACAAAAAGAGAATTGAGTCCATGGGACTAGGGCAAAAATCATC
JMFS036A03+ CACTTGATGGCCAAGGGACAAAAAGAGAATTGAGTCCATGGGACTAGGGCAAAAATCATC
JMFF021M09+ CACTTGATGGCCAAGGGACAAAAAGAGAATTGAGTCCATGGGACTAGGGCAAAAATCATC
JMFF048M07+ CACTTGATGGCCAAGGGACAAAAAGAGAATTGAGTCCATGGGACTAGGGCAAAAATCATC
JMFF010J22+ CACTTGATGGCCAAGGGACAAAAAGAGAATTGAGTCCATGGGACTAGGGCAAAAATCATC
JMFS117A09+ CACTTGATGGCCAAGGGACAAAAAGAGAATTGAGTCCATGGGACTAGGGCAAAAATCATC
JMFS064G11+ CACTTGATGGCCAAGGGACAAAAAGAGAATTGAGTCCATGGGACTAGGGCAAAAATCATC
JMSF008O23+ AATCATC
JMFF042I04+ CACTTGATGGCCAAGGGACAAAAAGAGAATTGAGTCCATGGGACTAGGGCAAAAATCATC
JMSF037P20+ CACTTGATGGCCAAGGGACAAAAAGAGAATTGAGTCCATGGGACTAGGGCAAAAATCATC
JMSF046L15+ CACTTGATGGCCAAGGGACAAAAAGAGAATTGAGTCCATGGGACTAGGGCAAAAATCATC
JMFS060H08+ CACTTGATGGCCAAGGGACAAAAAGAGAATTGAGTCCATGGGACTAGGGCAAAAATCATC
                      ____________________________________________________________
consensus CACTTGATGGCCAAGGGACAAAAAGAGAATTGAGTCCATGGGACTAGGGCAAAAATCATC
 
. : . : . : . : . : . :
JMFF046M11+ ACCACCACTGAA-TTCAAGGAGCTTAGACATGGGTACAACAGCTGGAAAACCCTAGGGAG
JMFS077H03+ ACCACCACTGAA-TTCAAGGAGCTTAGACATGGGTACAACAGCTGGAAAACCCTAGGGAG
JMFS108H09+ ACCACCACTGAA-TTCAAGGAGCTTAGACATGGGTACAACAGCTGGAAAACCCTAGGGAG
JMSF033P11+ ACCACCACTGAA-TTCAAGGAGCTTAGACATGGGTACAACAGCTGGAAAACCCTAGGGAG
JMFS112G01+ ACCACCACTGAA-TTCAAGGAGCTTAGACATGGGTACAACAGCTGGAAAACCCTAGGGAG
JMFS092D08+ ACCACCACTGAA-TTCAAGGAGCTTAGACATGGGTACAACAGCTGGAAAACCCTAGGGAG
JMFS068C04+ ACCACCACTGAA-TTCAAGGAGCTTAGACATGGGTACAACAGCTGGAAAACCCTAGGGAG
JMFS112H08+ ACCACCACTGAA-TTCAAGGAGCTTAGACATGGGTACAACAGCTGGAAAACCCTAGGGAG
JMFS048B07+ ACCTCCATTAAT-TTCAAGGATCTTATTCAGGGGAACAACAGCTGGATAACCTTAGGGAG
JMFF037K12+ ACCNCCACTGAA-TTCAAGGAGCTTAGACATGGGTACAACAGCTGGAAAACCCTAGGGAG
JMFS155C12+ ACCACCACTGAA-TTCAAGGAGCTTAGACATGGGTACAACAGCTGGAAAACCCTAGGGAG
JMFS036A03+ ACCACCACTGAA-TTCAAGGAGCTTAGACATGGGTACAACAGCTGGAAAACCCTAGGGAG
JMFF021M09+ ACCACCACTGAA-TTCAAGGAGCTTAGACATGGGTACAACAGCTGGAAAACCCTAGGGAG
JMFF048M07+ ACCACCACTGAA-TTCAAGGAGCTTAGACATGGGTACAACAGCTGGAAAACCCTAGGGAG
JMFF010J22+ ACCACCACTGAA-TTCAAGGAGCTTAGACATGGGTACAACAGCTGGAAAACCCTAGGGAG
JMFS117A09+ ACCACCACTGAA-TTCAAGGAGCTTAAACATGGGTACAACAGCTGGAAAACCCTAGGGAG
JMFS064G11+ ACCACCACTGAA-TTCAAGGAGCTTAGACATGGGTACAACAGCTGGAAAACCCTAGGGAG
JMSF008O23+ ACCACCACTGAATTTCAAGGAGCTTAGACATGGGTACAACAGCTGGAAAACCCTAGGGAG
JMFF042I04+ ACCACCACTGAA-TTCAAGGAGCTTAGACATGGGTACAACAGCTGGAAAACCCTAGGGAG
JMSF037P20+ ACCACCACTGAA-TTCAAGGAGCTTAGACATGGGTACAACAGCTGGAAAACCCTAGGGAG
JMSF046L15+ ACCNCCACTGAA-TTCAAGGAGCTTAGACATGGGTNCAACAGCTGGAAAACCCTAGGGAG
JMFS060H08+ ACCACCACTGAA-TTCAAGGAGCTTAGACATGGGTACAACAGCTGGAAAACCCTAGGGAG
                      ____________________________________________________________
consensus ACCACCACTGAA-TTCAAGGAGCTTAGACATGGGTACAACAGCTGGAAAACCCTAGGGAG
 
. : . : . : . : . : . :
JMFF046M11+ ATCAAATCCGAAAGGCAAGAGCCCCAAAAACCCTCCAAAGAGAGCAAAAACTGAGGGCTG
JMFS077H03+ ATCAAATCCGAAAGGCAAGAGCCCCAAAAACCCTCCAAAGAGAGCAAAAACTGAGGGCTG
JMFS108H09+ ATCAAATCCGAAAGGCAAGAGCCCCAAAAACCCTCCAAAGAGAGCAAAAACTGAGGGCTG
JMSF033P11+ ATCAAATCCGAAAGGCAAGAGCCCCAAAAACCCTCCAAAGAGAGCAAAAACTGAGGGCTG
JMFS112G01+ ATCAAATCCGAAAGGCAAGAGCCCCAAAAACCCTCCAAAGAGAGCAAAAACTGAGGGCTG
JMFS092D08+ ATCAAATCCGAAAGGCAAGAGCCCCAAAAACCCTCCAAAGAGAGCAAAAACTGAGGGCTG
JMFS068C04+ ATCAAATCCGAAAGGCAAGAGCCCCAAAAACCCTCCAAAGAGAGCAAAAACTGAGGGCTG
JMFS112H08+ ATCAAATCCGAAAGGCAAGAGCCCCAAAAACCCTCCAAAGAGAGCAAAAACTGAGGGCTG
JMFS048B07+ ATCAAATCGGAAAGGCAAGAGCCCCATAAACCCTCCAAAGAGAGCAAATATTTAGGGCTG
JMFF037K12+ ATCAAATCCGAAAGGCAAGAGCCCCAAAAACCCTCCAAAGAGAGCAAAAACTGAGGGCTG
JMFS155C12+ ATCAAATCCGAAAGGCAAGAGCCCCAAAAACCCTCCAAAGAGAGCAAAAACTGAGGGCTG
JMFS036A03+ ATCAAATCCGAAAGGCAAGAGCCCCAAAAACCCTCCAAAGAGAGCAAAAACTGAGGGCTG
JMFF021M09+ ATCAAATCCGAAAGGCAAGAGCCCCAAAAACCCTCCAAAGAGAGCAAAAACTGAGGGCTG
JMFF048M07+ ATCAAATCCGAAAGGCAAGAGCCCCAAAAACCCTCCAAAGAGAGCAAAAACTGAGGGCTG
JMFF010J22+ ATCAAATCCGAAAGGCAAGAGCCCCAAAAACCCTCCAAAGAGAGCAAAAACTGAGGGCTG
JMFS117A09+ ATCAAATCCGAAAGGCAAGAGCCCCAAAAACCCTACAAAGAGAGCAAAAACTGAGGGCTG
JMFS064G11+ ATCAAATCCGAAAGGCAAGAGCCCCAAAAACCCTCCAAAGAGAGCAAAAACTGAGGGCTG
JMSF008O23+ ATCAAATCCGAAAGGCAAGAGCCCCAAAAACCCTCCAAAGAGAGCAAAAACTGAGGGCTG
JMFF042I04+ ATCAAATCCGAAAGGCAAGAGCCCCAAAAACCCTCCAAAGAGAGCAAAAACTGAGGGCTG
JMSF037P20+ ATCAAATCCGAAAGGCAAGAGCCCCAAAAACCCTCCAAAGAGAGCAAAAACTGAGGGCTG
JMSF046L15+ ATCAAATCCGAAAGGCAAGAGCCCCAAAAACCCTCCAAAGAGAGCANAAACTGAGGGCTG
JMSF005A17+ CCGAAAGNCAAGAGCCCCAAAANCCNTCCAAAGAGAGCAAAAACTGAGGGCTG
JMFS060H08+ ATCAAATCCGAAAGGCAAGAGCCCCAAAAACCCTCCAAAGAGAGCAAAAACTGAGGGCTG
                      ____________________________________________________________
consensus ATCAAATCCGAAAGGCAAGAGCCCCAAAAACCCTCCAAAGAGAGCAAAAACTGAGGGCTG
 
. : . : . : . : . : . :
JMFF046M11+ AATCAAGAACAAAACCGTGACGACGAGTGATGATGATGATCAGTAGAGCTTCAAGAACTA
JMFS077H03+ AATCAAGAACAAAACCGTGACGACGA-TGATGATGATGATCAGTAGAGCTTCAAGAACTA
JMFS108H09+ AATCAAGAACAAAACCGTGACGACGA-TGATGATGATGATCAGTAGAGCTTCAAGAACTA
JMSF033P11+ AATCAAGAACAAAACCGTGACGACGA-TGATGATGATGATCAGTAGAGCTTCAAGAACTA
JMFS112G01+ AATCAAGAACAAAACCGTGACGACGA-TGATGATGATGATCAGTAGAGCTTCAAGAACTA
JMFS092D08+ AATCAAGAACAAAACCGTGACGACGA-TGATGATGATGATCAGTAGAGCTTCAAGAACTA
JMFS068C04+ AATCAAGAACAAAACCGTGACGACGA-TGATGATGATGATCAGTAGAGCTTCAAGAACTA
JMFS112H08+ AATCAAGAACAAAACCGTGACGACGA-TGATGATGATGATCAGTAGAGCTTCAAGAACTA
JMFS048B07+ AAGCAAGTACAAAACCGTGACGACGA-GANNGANGATGATCAGTAGAGCTNCAAGAACGA
JMFF037K12+ AATCAAGAACAAAACCGTGACGACGA-TGATGATGATGATCAGTAGAGCTTCAAGAACTA
JMFS155C12+ AATCAAGAACAAAACCGTGACGACGA-TGATGATGATGATCAGTAGAGCTTCAAGAACTA
JMFS036A03+ AATCAAGAACAAAACCGTGACGACGA-TGATGATGATGATCAGTAGAGCTTCAAGAACTA
JMFF021M09+ AATCAAGAACAAAACCGTGACGACGA-TGATGATGATGATCAGTAGAGCTTCAAGAACTA
JMFF048M07+ AATCAAGAACAAAACCGTGACGACGA-TGATGATGATGATCAGTAGAGCTTCAAGAACTA
JMFF010J22+ AATCAAGAACAAAACCGTGACGACGA-TGATGATGATGATCAGTAGAGCTTCAAGAACTA
JMFS117A09+ AATCAAGAACAAAACCGTGACGACGA-TGATGATGATGATCAGTAGAGCTTCAAGAACTA
JMFS064G11+ AATCAAGAACAAAACCGTGACGACGA-TGATGATGATGATCAGTAGAGCTTCAAGAACTA
JMSF008O23+ AATCAAGAACAAAACCGTGACGACGA-TGATGATGATGATCAGTAGAGCTTCAAGAACTA
JMFF042I04+ AATCAAGAACAAAACCGTGACGACGA-TGATGATGATGATCAGTAGAGCTTCAAGAACTA
JMSF037P20+ AATCAAGAACAAAACCGTGACGACGA-TGATGATGATGATCAGTAGAGCTTCAAGAACTA
JMSF046L15+ AATCAAGAACAAAACCGTGACGACGA-TGATGATGATGATCAGTAGAGCTTCAAGAACTA
JMSF013P19+ GACGACGA-TGATGATGATGATCAGTAGCGCTTCAAGAACTA
JMSF005A17+ AATCAAGAACAAAACCGTGACGACGA-TGATGATGATGATCAGTAGAGCTTCAAGAACTA
JMFS060H08+ AATCAAGAACAAAACCGTGACGACGA-TGATGATGATGATCAGTAGAGCTTCAAGAACTA
                      ____________________________________________________________
consensus AATCAAGAACAAAACCGTGACGACGA-TGATGATGATGATCAGTAGAGCTTCAAGAACTA
 
. : . : . : . : . : . :
JMFF046M11+ GATGCATCAGAGGGCTGGAAGGCAAGAGGTCATCAAG-AAACCCTATCGAACAGGGCAAA
JMFS077H03+ GATGCATCAGAGGGCTGGAAGGCAAGAGGTCATCAAG-AAACCCTATCAAACAGGGCAAA
JMFS108H09+ GATGCATCAGAGGGCTGGAAGGCAAGAGGTCATCAAG-AAACCCTATCAAACAGGGCAAA
JMSF033P11+ GATGCATCAGAGGGCTGGAAGGCAAGAGGTCATCAAG-AAACCCTATCAAACAGGGCAAA
JMFS112G01+ GATGCATCAGAGGGCTGGAAGGCAAGAGGTCATCAAG-AAACCCTATCAAACAGGGCAAA
JMFS092D08+ GATGCATCAGAGGGCTGGAAGGCAAGAGGTCATCAAG-AAACCCTATCAAACAGGGCAAA
JMFS068C04+ GATGCATCAGAGGGCTGGAAGGCAAGAGGTCATCAAG-AAACCCTATCAAACAGGGCAAA
JMFS112H08+ GATGCATCAGAGGGCTGGAAGGCAAGAGGTCATCAAG-AAACCCTATCAAACAGGGCAAA
JMFS048B07+ GAGGCATCAGAGGGNTGGAAGGCAAGAGGTGAGCAAG-AAACCNGATCAAACAGGGCAAA
JMFF037K12+ GATGCATCAGAGGGCTGGAAGGCAAGAGGTCATCAAG-AAACCCTATCAAACAGGGCAAA
JMFS155C12+ GATGCATCAGAGGGCTGGAAGGCAAGAGGTCATCAAG-AAACCCTATCAAACAGGGCAAA
JMFS036A03+ GATGCATCAGAGGGCTGGAAGGCAAGAGGTCATCAAG-AAACCCTATCAAACAGGGCAAA
JMFF021M09+ GATGCATCAGAGGGCTGGAAGGCAAGAGGTCATCAAG-AAACCCTATCAAACAGGGCAAA
JMFF048M07+ GATGCATCAGAGGGCTGGAAGGCAAGAGGTCATCAAG-AAACCCTATCAAACAGGGCAAA
JMFF010J22+ GATGCATCAGAGGGCTGGAAGGCAAGAGGTCATCAAG-AAACCCTATCAAACAGGGCAAA
JMFS117A09+ GATGCATCAGAGGGCTGGAAGGCAAGAGGTCATCAAG-AAACCCTATCAAACAGGGCAAA
JMFS064G11+ GATGCATCAGAGGGCTGGAAGGCAAGAGGTCATCAAG-AAACCCTATCAAACAGGGCAAA
JMSF008O23+ GATGCATCAGAGGGCTGGAAGGCAAGAGGTCATCAAG-AAACCCTATCAAACAGGGCAAA
JMFF042I04+ GATGCATCAGAGGGCTGGAAGGCAAGAGGTCATCAAG-AAACCCTATCAAACAGGGCAAA
JMSF037P20+ GATGCATCAGAGGGCTGGAAGGCAAGAGGTCATCAAG-AAACCCTATCAAACAGGGCAAA
JMSF046L15+ GATGCATCNGAGGGCTGGAAGNCAAGAGGTCATCAAGAAAACCCTATCAAACAGGGCAAA
JMSF013P19+ GATGCATCAGAGGGCTGGAAGGCAAGAGGTCATCAAG-AAACCCTATCAAACAGGGCAAA
JMSF005A17+ GATGCATCAGAGGGCTGGAAGGCAAGAGGTCATCAAG-AAACCCTATCAAACAGGGCAAA
JMFS060H08+ GATGCATCAGAGGGCTGGAAGGCAAGAGGTCATCAAG-AAACCCTATCAAACAGGGCAAA
                      ____________________________________________________________
consensus GATGCATCAGAGGGCTGGAAGGCAAGAGGTCATCAAG-AAACCCTATCAAACAGGGCAAA
 
. : . : . : . : . : . :
JMFF046M11+ AAAAGAAAAGAAAGAAAGAAAGCAATT
JMFS077H03+ AAAAGAAAAGAAAGAAAGAAAGCAAATTGGTGAAGGTGA
JMFS108H09+ AAAAGAAAAGAAAGAAAGAAAGCAAATTGGTGAAGGTGAGGGGCG
JMSF033P11+ AAAAGAAAAGAAAGAAAGAAAGCAAATTGGTGAAGGTGAGGGGCGGTGGGGGGTAATGGG
JMFS112G01+ AAAAGAAAAGAAAGAAAGAAAGCAAATTGGTGAAGGTGAGGGGCGGTGGG
JMFS092D08+ AAAAGAAAAGAAAGAAAGAAAGCAAATTGGTGAAGGTGA
JMFS068C04+ AAAAGAAAAGAAAGAAAGAAAGCAAATTGGTGAAGGTGAG
JMFS112H08+ AAAAGAAAAGAAAGAAAGAAAGCAAATTGGTGAAGGTGAGGG
JMFS048B07+ AAAAGAAAAGTAATAAAGATAGCAAANNGGAGAAGGTGAGGGGCG
JMFF037K12+ AAAAGAAAAGAAAGAAAGAAAGCAAATTGGTGAAGGTGAGGGGCGGTGGGGGGTAAT
JMFS155C12+ AAAAGAAAAGAAAGAAAGAAAGCAAATTGGTGAAGGTGA
JMFS036A03+ AAAAGAAAAGAAAGAAAGAAAGCAAATTGG
JMFF021M09+ AAAAGAAAAGAAAGAAAGAAAGCAATT
JMFF048M07+ AAAAGAAAAGAAAGAAAGAAAGCAATT
JMFF010J22+ AAAAGAAAAGAAAGAAAGAAAGCAATT
JMFS117A09+ AAAAGAAAAGAAAGAAAGAAAGCAAATTGGTGAAGGTGAGGGGCGGTGGG
JMFS064G11+ AAAAGAAAAGAAAGAAAGAAAGCAAATTGGTGAAGGT
JMSF008O23+ AAAAGAAAAGAAAGAAAGAAAGCAAATTGGTGAAGGTGAGGGGCGGTGGGGGGTAA
JMFF042I04+ AAAAGAAAAGAAAGAAAGAAAGCAAATTGGTGAAGGTGAGGGGCGGTGGGGGGTAATGGG
JMSF037P20+ AAAAGAAAAGAAAGAAAGAAAGCAAATTGGTGAAGGTGAGGGGCGGTGGGGGGTAATGGG
JMSF046L15+ AAAAGAAAAGAAAGAAAGAAAGCNAATTGGTGAAGGTGAGGGGCGGTGGGGGNTANTGGG
JMSF013P19+ AAAAGAAAAGAAAGAAAGAAAGCAAATTGGTGAAGGTGAGGGGCGGTGGGGGGTAATGGG
JMSF005A17+ AAAAGAAAAGAAAGAAAGAAAGCAAATTGGTGAAGGTGAGGGGCGGTGGGGGGTAATGGG
JMFS060H08+ AAAAGAAAAGAAAGAAAGAAAGCAAATTGGTGAAGGTGAGGGGCGGTGGGGGGTAATGGG
                      ____________________________________________________________
consensus AAAAGAAAAGAAAGAAAGAAAGCAAATTGGTGAAGGTGAGGGGCGGTGGGGGGTAATGGG
 
. : . : . : . : . : . :
JMSF033P11+ TATA
JMFF042I04+ TATAGG
JMSF037P20+ TATAGGAAAAAT
JMSF046L15+ TATAGGAAAAATGGGTGAAGGTGTGTTTATACAATGTATGTAT
JMSF013P19+ TATAGGAAAAATGGGTGAAGGTGTGTTTATACAATGTATGTATAGACTTTTGGTGGGTGG
JMSF005A17+ TATAGGAAAAAT
JMFS060H08+ TATAGGAAAAATGGGTGAAGGTGTGTTTATACAATGTATGTATAGACTTTTGGTGGGTGG
                      ____________________________________________________________
consensus TATAGGAAAAATGGGTGAAGGTGTGTTTATACAATGTATGTATAGACTTTTGGTGGGTGG
 
. : . : . : . : . : . :
JMSF013P19+ CAATGTGGCATTATCTTTATGTATGTATCATCTTTTGTTTGCATC
JMFS060H08+ CAATGTGGCATTATCTTTATGTATGTATCATCTTTTGTTTGCATCTTTGTGTGAAGGTGT
                      ____________________________________________________________
consensus CAATGTGGCATTATCTTTATGTATGTATCATCTTTTGTTTGCATCTTTGTGTGAAGGTGT