Previous Contig 003367:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS060D05Sequence600003367 (4)pir|T52602|T526027e-06squamosa promoter binding protein 1 [imported] - Arabidopsis thaliana>gb:ATH0116
JMFS066D01Sequence627003367 (4)pir|T47827|T478273e-44squamosa promoter binding protein-like 12 [imported] - Arabidopsis thaliana>gb:A
JMFS076A12Sequence642003367 (4)pir|T47827|T478271e-58squamosa promoter binding protein-like 12 [imported] - Arabidopsis thaliana>gb:A
JMFS159F07Sequence575003367 (4)pir|T47827|T478274e-17squamosa promoter binding protein-like 12 [imported] - Arabidopsis thaliana>gb:A

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS159F07+ TCAAGAGATCCAGTAACCACATCTGCAGGGACAGGCAATCTCT
                      ____________________________________________________________
consensus TCAAGAGATCCAGTAACCACATCTGCAGGGACAGGCAATCTCT
 
. : . : . : . : . : . :
JMFS159F07+ NTACATCTTCCGTTCCATCATCCGAATCAACATACATGTCATTCAAATCAAAAGTAATCA
                      ____________________________________________________________
consensus NTACATCTTCCGTTCCATCATCCGAATCAACATACATGTCATTCAAATCAAAAGTAATCA
 
. : . : . : . : . : . :
JMFS159F07+ ATTTGTTCCTGCCAGCAGAACTTTCCTGACCTGGTGCAGTAACCAAAGAACTGCTTTCAA
                      ____________________________________________________________
consensus ATTTGTTCCTGCCAGCAGAACTTTCCTGACCTGGTGCAGTAACCAAAGAACTGCTTTCAA
 
. : . : . : . : . : . :
JMFS159F07+ CAGAAAACATATTAACTGGTCTTTGAGAAGATGAAGCTCGCATATCTTCAACTCCGACAT
                      ____________________________________________________________
consensus CAGAAAACATATTAACTGGTCTTTGAGAAGATGAAGCTCGCATATCTTCAACTCCGACAT
 
. : . : . : . : . : . :
JMFS159F07+ CATGCACATCCAATCCTTTCGTTGGCATCTTGGAAGCAGAAGGTACAAGGTTGTTCTTTG
                      ____________________________________________________________
consensus CATGCACATCCAATCCTTTCGTTGGCATCTTGGAAGCAGAAGGTACAAGGTTGTTCTTTG
 
. : . : . : . : . : . :
JMFS159F07+ GGTCTTGAAGGGGCTTGAGACCCATTTGAGATCAAGGCCGATATCATATCTGAATCTCTA
JMFS076A12+ TGAGATCAAGGCCGATATCATATCTGAATCTCTA
                      ____________________________________________________________
consensus GGTCTTGAAGGGGCTTGAGACCCATTTGAGATCAAGGCCGATATCATATCTGAATCTCTA
 
. : . : . : . : . : . :
JMFS159F07+ AAAGCAGGCCCATTGTTCAGCAAGTTTGAAGACTCATTTAGAATCCCAGACATACTTTTG
JMFS076A12+ AAAGCAGGCCCATTGTTCAGCAAGTTTGAAGACTCATTTAGAATCCCAGATATACTTTTG
                      ____________________________________________________________
consensus AAAGCAGGCCCATTGTTCAGCAAGTTTGAAGACTCATTTAGAATCCCAGATATACTTTTG
 
. : . : . : . : . : . :
JMFS159F07+ TCCCCAGACAAGGCACCTTGGCTAGCAAGGCTCTTTAGAAGGTGAGATAGCAAGTCCTGA
JMFS076A12+ TCCCCAGACAAGGCACCTTGGCTAGCAAGGCTCTTTAGAAGGTGAGATAGCAAGTCCTGA
                      ____________________________________________________________
consensus TCCCCAGACAAGGCACCTTGGCTAGCAAGGCTCTTTAGAAGGTGAGATAGCAAGTCCTGA
 
. : . : . : . : . : . :
JMFS159F07+ TCTTCTGTAGAGTTCCCTCTGTTTGAGTGCATGTTGGCGAGTATCTTCAGTAGGCTCATC
JMFS076A12+ TCTTCTGTAGAGTTCCCTCTGTTTGAGTGCATGTTGGCGAGTATCTTCAGTAGGCTCATC
JMFS066D01+ GGCTCATC
                      ____________________________________________________________
consensus TCTTCTGTAGAGTTCCCTCTGTTTGAGTGCATGTTGGCGAGTATCTTCAGTAGGCTCATC
 
. : . : . : . : . : . :
JMFS159F07+ AGTAAATAACCACTAGCCTGGCTATCATTCATGGTGTTGCTATTAATAACAG
JMFS076A12+ AGTAAATAACCACTAGCCTGGCTATCATTCATGGTGTTGCTATTAATAACAGTCTCTGGT
JMFS066D01+ AGTAAATAACCACTAGCCTGGCTATCATTCATGGTGTTGCTATTAATAACAGTCTCTGGT
                      ____________________________________________________________
consensus AGTAAATAACCACTAGCCTGGCTATCATTCATGGTGTTGCTATTAATAACAGTCTCTGGT
 
. : . : . : . : . : . :
JMFS076A12+ TGTGTTTTCCTTCTCCTTTTATTATGACCAGCTAAACGTCTACGGCAACTTCGTTTCCCA
JMFS066D01+ TGTGTTTTCCTTCTCCTTTTATTATGACCAGCTAAACGTCTACGGCAACTTCGTTTCCCA
                      ____________________________________________________________
consensus TGTGTTTTCCTTCTCCTTTTATTATGACCAGCTAAACGTCTACGGCAACTTCGTTTCCCA
 
. : . : . : . : . : . :
JMFS076A12+ TCATCAAACTCTTGAAGTGCATGAAACCTACTGCACTGTTGGCAGAAACGCTGCATAATG
JMFS066D01+ TCATCAAACTCTTGAAGTGCATGAAACCTACTGCACTGTTGGCAGAAACGCTGCATAATG
                      ____________________________________________________________
consensus TCATCAAACTCTTGAAGTGCATGAAACCTACTGCACTGTTGGCAGAAACGCTGCATAATG
 
. : . : . : . : . : . :
JMFS076A12+ TTGCCTACAAGTGCCTTGGTTGCCTTGGAATGCATCTCACAAACCTTATGCCTCCTGTGA
JMFS066D01+ TTGCCTACAAGTGCCTTGGTTGCCTTGGAATGCATCTCACAAACCTTATGCCTCCTGTGA
                      ____________________________________________________________
consensus TTGCCTACAAGTGCCTTGGTTGCCTTGGAATGCATCTCACAAACCTTATGCCTCCTGTGA
 
. : . : . : . : . : . :
JMFS076A12+ TAATCTTTGGCCTTACTGAGATCTGCCCCACAATCCTCAACTTGACAAACGGCACGGTTA
JMFS066D01+ TAATCTTTGGCCTTACTGAGATCTGCCCCACAATCCTCAACTTGACAAACGGCACGGTTA
                      ____________________________________________________________
consensus TAATCTTTGGCCTTACTGAGATCTGCCCCACAATCCTCAACTTGACAAACGGCACGGTTA
 
. : . : . : . : . : . :
JMFS076A12+ GAAGTTGGTCCAGACAACTTGATCTTTTTCCCAATGGTTCCATCCAAGGTTTGCAGTTCC
JMFS066D01+ GAAGTTGGTCCAGACAACTTGATCTTTTTCCCAATGGTTCCATCCAAGGTTTGCAGTTCC
                      ____________________________________________________________
consensus GAAGTTGGTCCAGACAACTTGATCTTTTTCCCAATGGTTCCATCCAAGGTTTGCAGTTCC
 
. : . : . : . : . : . :
JMFS076A12+ CTGTCATTACTAGGAAATCGTCGTTCTCCAAGCTTCAAGGTAAGAGTACCAGTCTCACCA
JMFS066D01+ CTGTCATTACTAGGAAATCGTCGTTCTCCAAGCTTCAAGGTAAGAGTACCAGTCTCACCA
JMFS060D05+ CTGTCATTACTAGGAAATCGTCGTTCTCCAAGCTTCAAGGTAAGAGTACCAGTCTCACCA
                      ____________________________________________________________
consensus CTGTCATTACTAGGAAATCGTCGTTCTCCAAGCTTCAAGGTAAGAGTACCAGTCTCACCA
 
. : . : . : . : . : . :
JMFS076A12+ CCTTCAAG
JMFS066D01+ CCTTCAAGGTTATCTTCCTCAACCACAATAACCCTCTGCCGCTTTTCCAATTCTCTTGTC
JMFS060D05+ CCTTCAAGGTTATCTTCCTCAACCACAATAACCCTCTGCCGCTTTTCCAATTCTCTTGTC
                      ____________________________________________________________
consensus CCTTCAAGGTTATCTTCCTCAACCACAATAACCCTCTGCCGCTTTTCCAATTCTCTTGTC
 
. : . : . : . : . : . :
JMFS066D01+ TCTTTCTCAGACCCAATATTTACTTCATCGGAGCAAGAGGAGGAACTATTGGAGGTGGAT
JMFS060D05+ TCTTTCTCAGACCCAATATTTACTTCATCGGAGCAAGAGGAGGAACTATTGGAGGTGGAT
                      ____________________________________________________________
consensus TCTTTCTCAGACCCAATATTTACTTCATCGGAGCAAGAGGAGGAACTATTGGAGGTGGAT
 
. : . : . : . : . : . :
JMFS066D01+ GACACCACGGCTGTGGAGATTCCAGTTTCAAGTGGGAAAAACTGCCTGCTCTGGTAATTT
JMFS060D05+ GACACCACGGCTGTGGAGATTCCAGTTTCAAGTGGGAAAAACTGCCTGCTCTGGTAATTT
                      ____________________________________________________________
consensus GACACCACGGCTGTGGAGATTCCAGTTTCAAGTGGGAAAAACTGCCTGCTCTGGTAATTT
 
. : . : . : . : . : . :
JMFS066D01+ GATGATGGGTTGGGATTGA
JMFS060D05+ GATGATGGGTTGGGATTGAGAGGTCTGGCAAGGAAAAGATGGCCATCCCATTTCCAATCA
                      ____________________________________________________________
consensus GATGATGGGTTGGGATTGAGAGGTCTGGCAAGGAAAAGATGGCCATCCCATTTCCAATCA
 
. : . : . : . : . : . :
JMFS060D05+ CTGGGATCCCACTCCAGACTCCTTTTCCCCACCGCTCTCAAATCCGCTTAAATGAAGCTA
                      ____________________________________________________________
consensus CTGGGATCCCACTCCAGACTCCTTTTCCCCACCGCTCTCAAATCCGCTTAAATGAAGCTA
 
. : . : . : . : . : . :
JMFS060D05+ ATCGGCCTCAGTTCGGCCCCAGAAGTCAAGAAACACTACAGAAATAGATCCATGGTTCCA
                      ____________________________________________________________
consensus ATCGGCCTCAGTTCGGCCCCAGAAGTCAAGAAACACTACAGAAATAGATCCATGGTTCCA
 
. : . : . : . : . : . :
JMFS060D05+ ATTAAGAGCTACCCACATGCCCGTCTCCTAATTAAATTTTGAAAAAGCTCAAATCCGCTC
                      ____________________________________________________________
consensus ATTAAGAGCTACCCACATGCCCGTCTCCTAATTAAATTTTGAAAAAGCTCAAATCCGCTC
 
. : . : . : . : . : . :
JMFS060D05+ AGTCTTGATAACGAACTGCCTCCATACAGGAACGACCGAGATAAGGATGGACGGAAAGCG
                      ____________________________________________________________
consensus AGTCTTGATAACGAACTGCCTCCATACAGGAACGACCGAGATAAGGATGGACGGAAAGCG
 
. : . : . : . : . : . :
JMFS060D05+ GCGAACGGCGGGGAGTTGGGCAGAGGATGGTTGTAGCTAAAGCCTAAAGCCGAAAGGTTG
                      ____________________________________________________________
consensus GCGAACGGCGGGGAGTTGGGCAGAGGATGGTTGTAGCTAAAGCCTAAAGCCGAAAGGTTG