Previous Contig 003363:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS019E04Sequence526003363 (2)pir|G86218|G862185e-18protein F22O13.10 [imported] - Arabidopsis thaliana>gb:AE005172_889867 Arabidops
JMFS059G10Sequence628003363 (2)pir|T00715|T007152e-09hypothetical protein F22O13.10 - Arabidopsis thaliana

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS019E04+ TTGGCAATTGACACACTCTTCACAT
                      ____________________________________________________________
consensus TTGGCAATTGACACACTCTTCACAT
 
. : . : . : . : . : . :
JMFS019E04+ CCACGGATAACCCCTTTAGGAAGCTGTGGCCTGAAGGAGACCTTCTGCTCAGAGTCAGAT
JMFS059G10+ GAAGNAGACCTTCTGCTCAGAGTCAGAT
                      ____________________________________________________________
consensus CCACGGATAACCCCTTTAGGAAGCTGTGGCCTGAAGGAGACCTTCTGCTCAGAGTCAGAT
 
. : . : . : . : . : . :
JMFS019E04+ TCATCTCCTGAGCTGTTCTCAACTTGGCCATAGTTCATACAAGGTCTACGCCTTATAGAC
JMFS059G10+ TCATCTCCTGAGCTGTTCTCAACTTGGCCATAGTTCATACAAGGTCTACGCCTTATAGAC
                      ____________________________________________________________
consensus TCATCTCCTGAGCTGTTCTCAACTTGGCCATAGTTCATACAAGGTCTACGCCTTATAGAC
 
. : . : . : . : . : . :
JMFS019E04+ TTCAGTTTTGCATCCTCCACACCCTCTAAATCAGGTTCAACCTTAGCTCTCTGTAATTGC
JMFS059G10+ TTCAGTTTTGCATCCTCCACACCCTCTAAATCAGGTTCAACCTTAGCTCTCTGTAATTGC
                      ____________________________________________________________
consensus TTCAGTTTTGCATCCTCCACACCCTCTAAATCAGGTTCAACCTTAGCTCTCTGTAATTGC
 
. : . : . : . : . : . :
JMFS019E04+ ATTTCACTTGAAGAGGCTAAGCAATTAGTTTTCTTTTCATTATCTTTGACCTTTTCCAGG
JMFS059G10+ ATTTCACTTGAAGAGGCTAAGCAATTAGTTTTCTTTTCATTATCTTTGACCTTTTCCAGG
                      ____________________________________________________________
consensus ATTTCACTTGAAGAGGCTAAGCAATTAGTTTTCTTTTCATTATCTTTGACCTTTTCCAGG
 
. : . : . : . : . : . :
JMFS019E04+ GTGAAGGATGCAAGTGACTCAAATCCAGGTGGAATTGTTGACATATCTATAGTTTCATCC
JMFS059G10+ GTGAAGGATGCAAGTGACTCAAATCCAGGTGGAATTGTTGACATATCTATAGTTTCATCC
                      ____________________________________________________________
consensus GTGAAGGATGCAAGTGACTCAAATCCAGGTGGAATTGTTGACATATCTATAGTTTCATCC
 
. : . : . : . : . : . :
JMFS019E04+ TTGACGCAGTGACTAAAGAGTTCTGTCCCCATGATAT---------------ATATGCAT
JMFS059G10+ TTGACGCAGTGACTAAAGAGTTCTGTCCCCATGATATCTGTTTAGCAATGAAATATGCAT
                      ____________________________________________________________
consensus TTGACGCAGTGACTAAAGAGTTCTGTCCCCATGATATCTGTTTAGCAATGAAATATGCAT
 
. : . : . : . : . : . :
JMFS019E04+ GTATGCTTGATCTTAGATCAAACTTTTCCAGTGACCTCAAGCAGCTGAAACTCCAAACCA
JMFS059G10+ GTATGCTTGATCTTAGATCAAACTTTTCCAGTGACCTCAAGCAGCTGAAACTCCAAACCA
                      ____________________________________________________________
consensus GTATGCTTGATCTTAGATCAAACTTTTCCAGTGACCTCAAGCAGCTGAAACTCCAAACCA
 
. : . : . : . : . : . :
JMFS019E04+ CCACTCCAATAGGTCAAGGCAATCTACAGCCCCTAGCCAGTGTGGGCACCCATCAACATT
JMFS059G10+ CCACTCCAATAGGTCAAGGCAATCTACAGCCCCTAGCCAGTGTGGGCACCCATCAACATT
                      ____________________________________________________________
consensus CCACTCCAATAGGTCAAGGCAATCTACAGCCCCTAGCCAGTGTGGGCACCCATCAACATT
 
. : . : . : . : . : . :
JMFS019E04+ TACCAACTAACCAAAATTGT-TTTTGACCCGACCCTT
JMFS059G10+ TACCAACTAACCAAAATTGTATTTTGACCCGACCCTTATGACCCACTACATCTACTACAC
                      ____________________________________________________________
consensus TACCAACTAACCAAAATTGTATTTTGACCCGACCCTTATGACCCACTACATCTACTACAC
 
. : . : . : . : . : . :
JMFS059G10+ ATCTACTTTTCAGCCTTTCATTTCTCCCCACCCCCAAAGCCTCTTGCAGGCAGAGAAGAA
                      ____________________________________________________________
consensus ATCTACTTTTCAGCCTTTCATTTCTCCCCACCCCCAAAGCCTCTTGCAGGCAGAGAAGAA
 
. : . : . : . : . : . :
JMFS059G10+ GTAAATTCAAGAGAAAGGACAAATGAAATCCAGATATAGTTTCCTAATTTTGTTATTTGG
                      ____________________________________________________________
consensus GTAAATTCAAGAGAAAGGACAAATGAAATCCAGATATAGTTTCCTAATTTTGTTATTTGG