Previous Contig 003362:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS059G06Sequence573003362 (2)gb:AF367304_17917561e-13Arabidopsis thaliana AT5g36940/MLF18_60 mRNA, complete cds.
JMSF007P05Sequence180003362 (2)760022241gb:AF367304_17917565e-42Arabidopsis thaliana AT5g36940/MLF18_60 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS059G06+ TAGAATATAAACCCCAGCACCAACTGTGGAACC
                      ____________________________________________________________
consensus TAGAATATAAACCCCAGCACCAACTGTGGAACC
 
. : . : . : . : . : . :
JMFS059G06+ AACACCTATGGCAATTAGGTGAGGGATGGTCAATGCCTTAGCCAACTGATGATGATGCAC
                      ____________________________________________________________
consensus AACACCTATGGCAATTAGGTGAGGGATGGTCAATGCCTTAGCCAACTGATGATGATGCAC
 
. : . : . : . : . : . :
JMFS059G06+ TCTACCATGCCCGGAAGAAGAAATAGAAGAAGGAGAAGAGGATGATGATGGATTTGAATG
                      ____________________________________________________________
consensus TCTACCATGCCCGGAAGAAGAAATAGAAGAAGGAGAAGAGGATGATGATGGATTTGAATG
 
. : . : . : . : . : . :
JMFS059G06+ AGCAGAAGAAGCAGCAGCGGCAGAATCAACCTGCTTCCTCCTCACAAGGCTTCTCAACCC
                      ____________________________________________________________
consensus AGCAGAAGAAGCAGCAGCGGCAGAATCAACCTGCTTCCTCCTCACAAGGCTTCTCAACCC
 
. : . : . : . : . : . :
JMFS059G06+ CCCAGAAAAATACCCTCTTTCACAACCGCCACTCTTTTGCCAATCAGAAACAAATCCCAT
                      ____________________________________________________________
consensus CCCAGAAAAATACCCTCTTTCACAACCGCCACTCTTTTGCCAATCAGAAACAAATCCCAT
 
. : . : . : . : . : . :
JMFS059G06+ TCCACTTCTTCAGCTTCCAAATGTTTCAATCCAAAAGATGTCGTCGTCTTTGTGATACCT
                      ____________________________________________________________
consensus TCCACTTCTTCAGCTTCCAAATGTTTCAATCCAAAAGATGTCGTCGTCTTTGTGATACCT
 
. : . : . : . : . : . :
JMSF007P05+ TTTTTTTTTTCTTGTGTAAATGGGCAAGTATCAAATGCTGAATTCACTCTTTTAAG
JMFS059G06+ TTTTTTTTTTTTTTCTTGTGTAAATGGGCAAGTATCAAATGCTGAATTCACTCTTTTAAG
                      ____________________________________________________________
consensus TTTTTTTTTTTTTTCTTGTGTAAATGGGCAAGTATCAAATGCTGAATTCACTCTTTTAAG
 
. : . : . : . : . : . :
JMSF007P05+ TTAGTATATGAGAAAAGAAATTTAAAAAACAGTGTGCAAAATGTATGCACAAAAGTATAG
JMFS059G06+ TTAGTATATGAGAAAAGAAATTTAAAAACCAGTGTGCAAAATGTATGCACAAAAGTATAG
                      ____________________________________________________________
consensus TTAGTATATGAGAAAAGAAATTTAAAAACCAGTGTGCAAAATGTATGCACAAAAGTATAG
 
. : . : . : . : . : . :
JMSF007P05+ GAGAAGGGAGGAGAGTCCTATGGTATAGTGGATTCTCCGGAAAGAAGGAAGTGGGCTGC
JMFS059G06+ GAGAAGGGAGGAGAGTCCTATGGTATAGTGGATTCTCCGGAAAGAAGGAAGTGGGCTGCG
                      ____________________________________________________________
consensus GAGAAGGGAGGAGAGTCCTATGGTATAGTGGATTCTCCGGAAAGAAGGAAGTGGGCTGCG
 
. : . : . : . : . : . :
JMFS059G06+ GCTGCGTGCGAAATAATAGGAGCGGGTAGATAGGCATCAGAGATTCAGTCGATACGCCCC
                      ____________________________________________________________
consensus GCTGCGTGCGAAATAATAGGAGCGGGTAGATAGGCATCAGAGATTCAGTCGATACGCCCC