Previous Contig 003359:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015P01Sequence569007751 (2)gb:MTR430608_16876525e-23Medicago truncatula mRNA for squalene monooxygenase 2 (sqp2 gene).663003359 (3)gb:MTR430608_16876528e-60Medicago truncatula mRNA for squalene monooxygenase 2 (sqp2 gene).
JMFS059E04Sequence514003359 (3)gb:AC135157_17419932e-30Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1017C11, complete se
JMSF046O16Sequence641007751 (2)gb:MTR430608_16876527e-56Medicago truncatula mRNA for squalene monooxygenase 2 (sqp2 gene).118003359 (3)gb:MTR430609_16876534e-07Medicago truncatula mRNA for squalene monooxygenase 1 (sqp1 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF015P01+ ACGATGCACCCCACTCTC
                      ____________________________________________________________
consensus ACGATGCACCCCACTCTC
 
. : . : . : . : . : . :
rJMFF015P01+ TGCAAATATTTGGAATCTTTTTACACCTTGCGGAAGCCCGTGGCATCGACCATCAATACA
                      ____________________________________________________________
consensus TGCAAATATTTGGAATCTTTTTACACCTTGCGGAAGCCCGTGGCATCGACCATCAATACA
 
. : . : . : . : . : . :
rJMFF015P01+ TTGGCAGGTGCACTTTACAAAGTGTTTTGCGCCTCGCCCGATCAAGCAAGGAAAGAAATG
                      ____________________________________________________________
consensus TTGGCAGGTGCACTTTACAAAGTGTTTTGCGCCTCGCCCGATCAAGCAAGGAAAGAAATG
 
. : . : . : . : . : . :
rJMFF015P01+ CGGCAGGCGTGCTTCGATTACTTGAGCCTCGGAGGGGTTTTCTCGAACGGCCCCGTGTCT
JMFS059E04- CCTCGGAGGGGTTTTCTCGAACGGCCCCGTGTCT
                      ____________________________________________________________
consensus CGGCAGGCGTGCTTCGATTACTTGAGCCTCGGAGGGGTTTTCTCGAACGGCCCCGTGTCT
 
. : . : . : . : . : . :
rJMFF015P01+ CTGCTCTCCGGGTTGAACCCTCGACCACTGAGCCTCGTCTGCCATTTCTTTGCTGTTGCA
JMFS059E04- CTGCTCTCCGGGTTGAACCCTCGACCACTGAGCCTCGTCTGCCATTTCTTTGCTGTTGCA
                      ____________________________________________________________
consensus CTGCTCTCCGGGTTGAACCCTCGACCACTGAGCCTCGTCTGCCATTTCTTTGCTGTTGCA
 
. : . : . : . : . : . :
rJMFF015P01+ ATCTATGGCGTGGGGCGTTTGCTGCTGCCTTTCCCCTCGCTCAAACGGATGTGGATCGGA
rJMSF046O16+ GATGNGGATCGGN
JMFS059E04- ATCTATGGCGTGGGGCGTTTGCTGCTGCCTTTCCCCTCGCTCAAACGGATGTGGATCGGA
                      ____________________________________________________________
consensus ATCTATGGCGTGGGGCGTTTGCTGCTGCCTTTCCCCTCGCTCAAACGGATGTGGATCGGA
 
. : . : . : . : . : . :
rJMFF015P01+ GCAAGATTAATCTCGAGTGCATCGGCCATCATCCTCCCCATCATCAAGGCAGAAGGAGTT
rJMSF046O16+ GCAAGANTAATCTNGAGTGCATCGNCCATCATCCTCNCCATCATCANGGCAGAAGGAGTN
JMFS059E04- GCAAGATTAATCTCGAGTGCATCGGCCATCATCCTCCCCATCATCAAGGCAGAAGGAGTT
                      ____________________________________________________________
consensus GCAAGATTAATCTCGAGTGCATCGGCCATCATCCTCCCCATCATCAAGGCAGAAGGAGTT
 
. : . : . : . : . : . :
rJMFF015P01+ AGGCAGATGTTCTTCCCGGCGACTGTTCCGGCATATTACAGAGCTCCTCCTGCGTCCTGC
rJMSF046O16+ AGNCAGATGTTNTTCCCGGCGACTGTTCCGGCATATTACAGAGCT
JMFS059E04- AGGCAGATGTTCTTCCCGGCGACTGTTCCGGCATATTACAGAGCTCCTCCTGCGTCCTGC
                      ____________________________________________________________
consensus AGGCAGATGTTCTTCCCGGCGACTGTTCCGGCATATTACAGAGCTCCTCCTGCGTCCTGC
 
. : . : . : . : . : . :
rJMFF015P01+ TAAATCAAAGCGGCGGCCGGCCGCGGGGATATATGCTTCCATTCAACAAATATATTATTG
JMFS059E04- TAAATCAAAGCGGCGGCCGGCCGCGGGGATATATGCTTCCATTCAACAAATATATTATTG
                      ____________________________________________________________
consensus TAAATCAAAGCGGCGGCCGGCCGCGGGGATATATGCTTCCATTCAACAAATATATTATTG
 
. : . : . : . : . : . :
rJMFF015P01+ TATCTCTAATTTGTCTCTTTCTCCACTTTTGTTCATTAACTTCAAGTAAATATTGTGCAC
JMFS059E04- TATCTCTAATTTGTCTCTTTCTCCACTTTTGTTCATTAACTTCAAGTAAATATTGTGCAC
                      ____________________________________________________________
consensus TATCTCTAATTTGTCTCTTTCTCCACTTTTGTTCATTAACTTCAAGTAAATATTGTGCAC
 
. : . : . : . : . : . :
rJMFF015P01+ AACATTTATAGATTCCTGTCTCATGTACTCTCCAGCATCAATCTTTTACAGATTACTATG
JMFS059E04- AACATTTATAGATTCCTGTCTCATGTACTCTCCAGCATCAATCTTTTACAGATTACTATG
                      ____________________________________________________________
consensus AACATTTATAGATTCCTGTCTCATGTACTCTCCAGCATCAATCTTTTACAGATTACTATG
 
. : . : . : . : . : . :
rJMFF015P01+ GCGATGTAATGTAAACTGTCAATTACTTCCTATGATTAAAATATA
JMFS059E04- GCGATGTAATGTAAACTGTCAATTACTTCCTATGATTAAAATATACTCCGTAGTTTAGAA
                      ____________________________________________________________
consensus GCGATGTAATGTAAACTGTCAATTACTTCCTATGATTAAAATATACTCCGTAGTTTAGAA