Previous Contig 003350:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS058E10Sequence627003350 (2)gb:AP003956_1835693e-111Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ14
JMFS125H01Sequence552003350 (2)gb:AP003956_18356936e-97Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ14

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS058E10+ AGTTGGTCCACAGCCACATTACTGGGA
                      ____________________________________________________________
consensus AGTTGGTCCACAGCCACATTACTGGGA
 
. : . : . : . : . : . :
JMFS125H01+ AGACCAAAACCTGGCCCTGGCCCTGTTTGGCCATATGATACACAATGGCAGCAGAT
JMFS058E10+ GCACAGACCAAAACCTGGCCCTGGCCCTGTTTGGCCATATGATACACAATGGCAGCAGAT
                      ____________________________________________________________
consensus GCACAGACCAAAACCTGGCCCTGGCCCTGTTTGGCCATATGATACACAATGGCAGCAGAT
 
. : . : . : . : . : . :
JMFS125H01+ GTGACAGTCTTTCCAGTGCCAGGGGGACCTTGAATCAGACTAATGGGCTTTTGAAGCACA
JMFS058E10+ GTGACAGTCTTTCCAGTGCCAGGGGGACCTTGAATCAGACTAATGGGCTTTTGAAGCACA
                      ____________________________________________________________
consensus GTGACAGTCTTTCCAGTGCCAGGGGGACCTTGAATCAGACTAATGGGCTTTTGAAGCACA
 
. : . : . : . : . : . :
JMFS125H01+ CTTTTTACAGCAAAAACTTGAGATGCATTGAGCTCAGGAAGACCAGGAGCACCAAAGCGG
JMFS058E10+ CTTTTTACAGCAAAAACTTGAGATGCATTGAGCTCAGGAAGACCAGGAGCACCAAAGCGG
                      ____________________________________________________________
consensus CTTTTTACAGCAAAAACTTGAGATGCATTGAGCTCAGGAAGACCAGGAGCACCAAAGCGG
 
. : . : . : . : . : . :
JMFS125H01+ CGGGGCAGTGTATTACGGACCAGCTGCATCTCAACTTCATGACCTAACAAGTGGTGATAA
JMFS058E10+ CGGGGCAGTGTATTACGGACCAGCTGCATCTCAACTTCATGACCTAACAAGTGGTGATAA
                      ____________________________________________________________
consensus CGGGGCAGTGTATTACGGACCAGCTGCATCTCAACTTCATGACCTAACAAGTGGTGATAA
 
. : . : . : . : . : . :
JMFS125H01+ ATGTACCCACTCACACTTGTCTCATCCACGGCAAAACTTTTCATTGCACTTTGCATCCGG
JMFS058E10+ ATGTACCCACTCACACTTGTCTCATCCACGGCAAAACTTTTCATTGCACTTTGCATCCGG
                      ____________________________________________________________
consensus ATGTACCCACTCACACTTGTCTCATCCACGGCAAAACTTTTCATTGCACTTTGCATCCGG
 
. : . : . : . : . : . :
JMFS125H01+ TCAAAGCTGGTACTCTTCCAGACAAAGTCAACACTAAACCCATGGTTAACATCAACAGGA
JMFS058E10+ TCAAAGCTGGTACTCTTCCAGACAAAGTCAACACTAAACCCATGGTTAACATCAACAGGA
                      ____________________________________________________________
consensus TCAAAGCTGGTACTCTTCCAGACAAAGTCAACACTAAACCCATGGTTAACATCAACAGGA
 
. : . : . : . : . : . :
JMFS125H01+ ACACCCTGACTAGCACGAAGTTCAAGTGCAACCTCCTCTTGTGCAGTTAGTTTTATCACA
JMFS058E10+ ACACCCTGACTAGCACGAAGTTCAAGTGCAACCTCCTCTTGTGCAGTTAGTTTTATCACA
                      ____________________________________________________________
consensus ACACCCTGACTAGCACGAAGTTCAAGTGCAACCTCCTCTTGTGCAGTTAGTTTTATCACA
 
. : . : . : . : . : . :
JMFS125H01+ TGCCCTACTGACTGCCAAGCTGGATGAGCTGCATCTCCTGAATAACGTAACCGCAACTCA
JMFS058E10+ TGCCCTACTGACTGCCAAGCTGGATGAGCTGCATCTCCTGAATAACGTAACCGCAACTCA
                      ____________________________________________________________
consensus TGCCCTACTGACTGCCAAGCTGGATGAGCTGCATCTCCTGAATAACGTAACCGCAACTCA
 
. : . : . : . : . : . :
JMFS125H01+ TCACCAGGTACAAGGCGCAACTCGTTATCTTCCTTAGGAAAAACAAAATATGCAATGCGC
JMFS058E10+ TCACCAGGTACAAGGCGCAACTCGTTATCTTCCTTAGGAAAAACAAAATATGCAATGCGC
                      ____________________________________________________________
consensus TCACCAGGTACAAGGCGCAACTCGTTATCTTCCTTAGGAAAAACAAAATATGCAATGCGC
 
. : . : . : . : . : . :
JMFS125H01+ TTCTTGTTTAGACCGA
JMFS058E10+ TTCTTGTTTAGACCGACATCCCAGCGAACAGTCAAATTGTCTTTACTCTGGGACTCTTTC
                      ____________________________________________________________
consensus TTCTTGTTTAGACCGACATCCCAGCGAACAGTCAAATTGTCTTTACTCTGGGACTCTTTC