Previous Contig 003347:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007F02Sequence524003347 (2)pir|G86175|G861753e-19protein F19P19.16 [imported] - Arabidopsis thaliana>gb:AE005172_889457 Arabidops704020787pir|G86175|G861753e-30protein F19P19.16 [imported] - Arabidopsis thaliana>gb:AE005172_889457 Arabidops
JMFS057F05Sequence618003347 (2)pir|G86175|G861753e-13protein F19P19.16 [imported] - Arabidopsis thaliana>gb:AE005172_889457 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS057F05+ CAAGGATGATAAAGGAAAAACAA
                      ____________________________________________________________
consensus CAAGGATGATAAAGGAAAAACAA
 
. : . : . : . : . : . :
JMFF007F02+ CAGGAAAATGAGATTCCAGCATTGAACTTGGCAAAACACTGACGATCTTTACAGCAA
JMFS057F05+ GAACAGGAAAATGAGATTCCAGCATTGAACTTGGCAAAACACTGACGATCTTTACAGCAA
                      ____________________________________________________________
consensus GAACAGGAAAATGAGATTCCAGCATTGAACTTGGCAAAACACTGACGATCTTTACAGCAA
 
. : . : . : . : . : . :
JMFF007F02+ GTTCAGAGGCCAAAATCAAAGTATCTTGACTTTTTGATCCAAGAATACTTCCCAATGCTC
JMFS057F05+ GTTCAGAGGCCAAAATCAAAGTATCTTGACTTTTTGATCCAAGAATACTTCCCAATGCTC
                      ____________________________________________________________
consensus GTTCAGAGGCCAAAATCAAAGTATCTTGACTTTTTGATCCAAGAATACTTCCCAATGCTC
 
. : . : . : . : . : . :
JMFF007F02+ CAATCATACCAGGGATTGAATCCTTTACAAGGGGGTGTCTTAATGTCTCAAGAGATAAAC
JMFS057F05+ CAATCATACCAGGGATTGAATCCTTTACAAGGGGGTGTCTTAATGTCTCAAGAGATAAAC
                      ____________________________________________________________
consensus CAATCATACCAGGGATTGAATCCTTTACAAGGGGGTGTCTTAATGTCTCAAGAGATAAAC
 
. : . : . : . : . : . :
JMFF007F02+ AATCAAGAAAGGCATCAATGGAACGGATTACAAGCTTTTGTCTGTCAAAGTCAGTAAAAT
JMFS057F05+ AATCAAGAAAGGCATCAATGGAACGGATTACAAGCTTTTGTCTGTCAAAGTCAGTAAAAT
                      ____________________________________________________________
consensus AATCAAGAAAGGCATCAATGGAACGGATTACAAGCTTTTGTCTGTCAAAGTCAGTAAAAT
 
. : . : . : . : . : . :
JMFF007F02+ TCCAGTTTGGTCCTTTGTCATCATAATATCCAACTCCGAGACCAAGAGCATGGTGAAGGC
JMFS057F05+ TCCAGTTTGGTCCTTTGTCATCATAATAT-----TCCGAGACCAAGAGCATGGTGAAGGC
                      ____________________________________________________________
consensus TCCAGTTTGGTCCTTTGTCATCATAATATCCAACTCCGAGACCAAGAGCATGGTGAAGGC
 
. : . : . : . : . : . :
JMFF007F02+ GCTGATGAAGAGTGACCATGTGGCCATTAACACCACGGTTGCTCTCAGCACCATGTTTTG
JMFS057F05+ GCTGATGAAGAGTGACCATGTGGCCATTAACACCACGGTTGCTCTCAGCACCATGTTTTG
                      ____________________________________________________________
consensus GCTGATGAAGAGTGACCATGTGGCCATTAACACCACGGTTGCTCTCAGCACCATGTTTTG
 
. : . : . : . : . : . :
JMFF007F02+ AGGATGATGGCCTCATCGGTGCTTGAATTTAAAGAAAATTTCCCCAAATGCTACCACAAA
JMFS057F05+ AGGATGATGGCCTCATCGGTGCTTGAATTTAAAGAAAATTTCCCCAAATGCTACCACAAA
                      ____________________________________________________________
consensus AGGATGATGGCCTCATCGGTGCTTGAATTTAAAGAAAATTTCCCCAAATGCTACCACAAA
 
. : . : . : . : . : . :
JMFF007F02+ TGGTAAGAAAAAATTGACAGCAAAGTTTGCTCCTTCTGCAGAAAATCTATGTGCTGAAGC
JMFS057F05+ TGGTAAGAAAAAATTGACAGCAAAGTTTGCTCCTTCTGCAGAAAATCTATGTGCTGAAGC
                      ____________________________________________________________
consensus TGGTAAGAAAAAATTGACAGCAAAGTTTGCTCCTTCTGCAGAAAATCTATGTGCTGAAGC
 
. : . : . : . : . : . :
JMFF007F02+ AGTTCTTCTCTCTCTATCATATGCTATATCGCATTGCAGCATCGAAC
JMFS057F05+ AGTTCTTCTCTCTCTATCATATGCTATATCGCATTGCAGCATCGAACGCCGTCTTCTCCT
                      ____________________________________________________________
consensus AGTTCTTCTCTCTCTATCATATGCTATATCGCATTGCAGCATCGAACGCCGTCTTCTCCT
 
. : . : . : . : . : . :
JMFS057F05+ TGCACAAAATTACATATCCGAACCGGATTGGAAACTGGAAACTGGAAACTGTAATTCTTA
                      ____________________________________________________________
consensus TGCACAAAATTACATATCCGAACCGGATTGGAAACTGGAAACTGGAAACTGTAATTCTTA