Previous Contig 003341:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN017F19Sequence627003341 (2)gb:AP002862_18232735e-26Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJN
JMFS056G05Sequence629003341 (2)gb:AP002862_18232737e-32Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJN

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN017F19+ ATGAGCTAA
                      ____________________________________________________________
consensus ATGAGCTAA
 
. : . : . : . : . : . :
JMFN017F19+ TCAACTACAAAAATCTAACAAATGTAGGCTAGGAGAAGTGGAATAGCTGTAACAACTAAG
                      ____________________________________________________________
consensus TCAACTACAAAAATCTAACAAATGTAGGCTAGGAGAAGTGGAATAGCTGTAACAACTAAG
 
. : . : . : . : . : . :
JMFN017F19+ CTCACACCAAATATGACACAAAAGCAACTAGCACAAACATCACTTGGAATATGCTTATAC
                      ____________________________________________________________
consensus CTCACACCAAATATGACACAAAAGCAACTAGCACAAACATCACTTGGAATATGCTTATAC
 
. : . : . : . : . : . :
JMFN017F19+ TGCACCTCACACCTCTATTTGGTGAGTTGTCGATGACAGGGATAGGCTGCGACTCTACTG
                      ____________________________________________________________
consensus TGCACCTCACACCTCTATTTGGTGAGTTGTCGATGACAGGGATAGGCTGCGACTCTACTG
 
. : . : . : . : . : . :
JMFN017F19+ GTGAAGATGCTGGATCAACATAGGGTGGAGGTGGGGGGTGGTTGAGACTTGGAGGAAGTC
JMFS056G05+ TGGGGGGTGGTTGAGACTTGGAGGAAGTC
                      ____________________________________________________________
consensus GTGAAGATGCTGGATCAACATAGGGTGGAGGTGGGGGGTGGTTGAGACTTGGAGGAAGTC
 
. : . : . : . : . : . :
JMFN017F19+ CAAGCCCATGGTCAACTTTGATTTCAAACGCCATGCCCTTTTGGCACTGGACCCCATCAT
JMFS056G05+ CAAGCCCATGGTCAACTTTGATTTCAAACGCCATGCCCTTTTGGCACTGGACCCCATCAT
                      ____________________________________________________________
consensus CAAGCCCATGGTCAACTTTGATTTCAAACGCCATGCCCTTTTGGCACTGGACCCCATCAT
 
. : . : . : . : . : . :
JMFN017F19+ TAGCGCCTGAAAAATAGTATTGCACGCCCTCTATGGTCAGTGGCACTGCTGCAGTTACTG
JMFS056G05+ TAGCGCCTGAAAAATAGTATTGCACGCCCTCTATGGTCAGTGGCACTGCTGCAGTTACTG
                      ____________________________________________________________
consensus TAGCGCCTGAAAAATAGTATTGCACGCCCTCTATGGTCAGTGGCACTGCTGCAGTTACTG
 
. : . : . : . : . : . :
JMFN017F19+ CTTTGCCAAATTCGTTGCTGCCTCCTAGAAACACGTAGGTGTCATCAGAAGCATCGTCCA
JMFS056G05+ CTTTGCCAAATTCGTTGCTGCCTCCTAGAAACACGTAGGTGTCATCAGAAGCATCGTCCA
                      ____________________________________________________________
consensus CTTTGCCAAATTCGTTGCTGCCTCCTAGAAACACGTAGGTGTCATCAGAAGCATCGTCCA
 
. : . : . : . : . : . :
JMFN017F19+ TGGTGCAGCTCTTATATGTGGTCTCGTTGTATGTTTGGATAACTGTCTGGTTAGTGTTTG
JMFS056G05+ TGGTGCAGCTCTTATATGTGGTCTCGTTGTATGTTTGGATAACTGTCTGGTTAGTGTTTG
                      ____________________________________________________________
consensus TGGTGCAGCTCTTATATGTGGTCTCGTTGTATGTTTGGATAACTGTCTGGTTAGTGTTTG
 
. : . : . : . : . : . :
JMFN017F19+ TATTGAAAATGAGGAAGTCCCCAAGATTGAAGGTTTGTTTGGCGGCCCAAGCAGAGTAGT
JMFS056G05+ TATTGAAAATGAGGAAGTCCCCAAGATTGAAGGTTTGTTTGGCGGCCCAAGCAGAGTAGT
                      ____________________________________________________________
consensus TATTGAAAATGAGGAAGTCCCCAAGATTGAAGGTTTGTTTGGCGGCCCAAGCAGAGTAGT
 
. : . : . : . : . : . :
JMFN017F19+ CGGCGGAGGTCTTTCCGGTGGTGACATTGAAGAACCACCCGGCGCCATCCCCGACTGTGT
JMFS056G05+ CGGCGGAGGTCTTTCCGGTGGTGACATTGAAGAACCACCCGGCGCCATCCCCGACTGTGT
                      ____________________________________________________________
consensus CGGCGGAGGTCTTTCCGGTGGTGACATTGAAGAACCACCCGGCGCCATCCCCGACTGTGT
 
. : . : . : . : . : . :
JMFN017F19+ GGTTGGTGTAAGCGTTGG
JMFS056G05+ GGTTGGTGTAAGCGTTGGGAGCAGGACTCTGAGATGCGGCACCAATGAAGAGCAGAGCTA
                      ____________________________________________________________
consensus GGTTGGTGTAAGCGTTGGGAGCAGGACTCTGAGATGCGGCACCAATGAAGAGCAGAGCTA
 
. : . : . : . : . : . :
JMFS056G05+ ATAGAAAGAGAGAGACCATGGCCTTCTCGATTGCCATGGTGGGAAGATGAGCTCCGCTTG
                      ____________________________________________________________
consensus ATAGAAAGAGAGAGACCATGGCCTTCTCGATTGCCATGGTGGGAAGATGAGCTCCGCTTG
 
. : . : . : . : . : . :
JMFS056G05+ GCTTAGGTTAAGAGTTGAGCGTTTGATTTGAAAATCTAAAATGCGAGAAATTGGATGTTT
                      ____________________________________________________________
consensus GCTTAGGTTAAGAGTTGAGCGTTTGATTTGAAAATCTAAAATGCGAGAAATTGGATGTTT
 
. : . : . : . : . : . :
JMFS056G05+ TGACTGTGACCATGGAGCCCTATATATCTCTCTCTATCTTCTTCGAGAATTTGAATCAAG
                      ____________________________________________________________
consensus TGACTGTGACCATGGAGCCCTATATATCTCTCTCTATCTTCTTCGAGAATTTGAATCAAG