Previous Contig 003340:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS008E05Sequence643003340 (9)gb:AB071286_15227406e-86Ipomoea batatas SBE II mRNA for starch branching enzyme II, complete cds.
JMFS015G03Sequence536003340 (9)gb:AB071286_15227402e-73Ipomoea batatas SBE II mRNA for starch branching enzyme II, complete cds.
JMFS049B02Sequence626003340 (9)gb:AB071286_15227409e-87Ipomoea batatas SBE II mRNA for starch branching enzyme II, complete cds.
JMFS050E11Sequence598003340 (9)gb:AB071286_15227402e-81Ipomoea batatas SBE II mRNA for starch branching enzyme II, complete cds.
JMFS050F03Sequence598003340 (9)gb:AB071286_15227402e-81Ipomoea batatas SBE II mRNA for starch branching enzyme II, complete cds.
JMFS056F09Sequence619003340 (9)gb:AB071286_15227402e-78Ipomoea batatas SBE II mRNA for starch branching enzyme II, complete cds.
JMFS154D06Sequence613003340 (9)gb:AB071286_15227402e-81Ipomoea batatas SBE II mRNA for starch branching enzyme II, complete cds.
JMFS169E12Sequence628003340 (9)gb:AB071286_15227403e-84Ipomoea batatas SBE II mRNA for starch branching enzyme II, complete cds.
JMSF004H07Sequence389003340 (9)gb:AB071286_15227401e-41Ipomoea batatas SBE II mRNA for starch branching enzyme II, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS049B02+ T
                      ____________________________________________________________
consensus T
 
. : . : . : . : . : . :
JMFS049B02+ GACCAAGTCCAGGAGNAGGAATGGCCCTCTTTTTCACCATTTCAGATTCAGCACTGATGT
JMFS169E12+ AGGAATGGCCCTCTTTTTCACCATTTCAGATTCAGCACTGATGT
JMFS154D06+ TTTTCACCATTTCAGATTCAGCACTGATGT
JMFS050E11+ TTTTCACCATTTCAGATTCAGCACTGATGT
JMFS050F03+ TTTTCACCATTTCAGATTCAGCACTGATGT
JMFS008E05+ GAGGAATGGCCCTCTTTTTCACCATTTCAGATTCAGCACTGATGT
JMFS056F09+ TCAGATTCAGCACTGATGT
                      ____________________________________________________________
consensus GACCAAGTCCAGGAGGAGGAATGGCCCTCTTTTTCACCATTTCAGATTCAGCACTGATGT
 
. : . : . : . : . : . :
JMFS049B02+ CATCCAAAGTATCTGGTTTTTGTGAAACTTCCACATTACCATCTTCTTCAAATTGTAGTG
JMFS169E12+ CATCCAAAGTATCTGGTTTTTGTGAAACTTCCACATTACCATCTTCTTCAAATTGTAGTG
JMFS154D06+ CATCCAAAGTATCTGGTTTTTGTGAAACTTCCACATTACCATCTTCTTCAAATTGTAGTG
JMFS050E11+ CATCCAAAGTATCTGGTTTTTGTGAAACTTCCACATTACCATCTTCTTCAAATTGTAGTG
JMFS050F03+ CATCCAAAGTATCTGGTTTTTGTGAAACTTCCACATTACCATCTTCTTCAAATTGTAGTG
JMFS015G03+ GTTTTTGTGAAACTTCCACATTACCATCTTCTTCAAATTGTAGTG
JMFS008E05+ CATCCAAAGTATCTGGTTTTTGTGAAACTTCCACATTACCATCTTCTTCAAATTGTAGTG
JMFS056F09+ CATCCAAAGTATCTGGTTTNTGTGAAACTTCCACATTACCATCTTCTTCAAATTGTAGTG
                      ____________________________________________________________
consensus CATCCAAAGTATCTGGTTTTTGTGAAACTTCCACATTACCATCTTCTTCAAATTGTAGTG
 
. : . : . : . : . : . :
JMFS049B02+ AAGACGTGAGATCCTGCTCTTGAACGCTTTCTTTAGAATCACTTGCTGCTTTGACGAAAT
JMFS169E12+ AAGACGTGAGATCCTGCTCTTGAACGCTTTCTTTAGAATCACTTGCTGCTTTGACGAAAT
JMFS154D06+ AAGACGTGAGATCCTGCTCTTGAACGCTTTCTTTAGAATCACTTGCTGCTTTGACGAAAT
JMFS050E11+ AAGACGTGAGATCCTGCTCTTGAACGCTTTCTTTAGAATCACTTGCTGCTTTGACGAAAT
JMFS050F03+ AAGACGTGAGATCCTGCTCTTGAACGCTTTCTTTAGAATCACTTGCTGCTTTGACGAAAT
JMFS015G03+ AAGACGTGAGATCCTGCTCTTGAACGCTTTCTTTAGAATCACTTGCTGCTTTGACGAAAT
JMFS008E05+ AAGACGTGAGATCCTGCTCTTGAACGCTTTCTTTAGAATCACTTGCTGCTTTGACGAAAT
JMFS056F09+ AAGACGTGAGATCCTGCTCTTGAACGCTTTCTTTAGAATCACTTGCTGCTTTGACGAAAT
                      ____________________________________________________________
consensus AAGACGTGAGATCCTGCTCTTGAACGCTTTCTTTAGAATCACTTGCTGCTTTGACGAAAT
 
. : . : . : . : . : . :
JMFS049B02+ CCACATTGCTTTCACTGTTGCTGTTCTCTTCCATTTTCACATTATCCACGTCAGCCGATA
JMFS169E12+ CCACATTGCTTTCACTGTTGCTGTTCTCTTCCATTTTCACATTATCCACGTCAGCCGATA
JMFS154D06+ CCACATTGCTTTCACTGTTGCTGTTCTCTTCCATTTTCACATTATCCACGTCAGCCGATA
JMFS050E11+ CCACATTGCTTTCACTGTTGCTGTTCTCTTCCATTTTCACATTATCCACGTCAGCCGATA
JMFS050F03+ CCACATTGCTTTCACTGTTGCTGTTCTCTTCCATTTTCACATTATCCACGTCAGCCGATA
JMFS015G03+ CCACATTGCTTTCACTGTTGCTGTTCTCTTCCATTTTCACATTATCCACGTCAGCCGATA
JMFS008E05+ CCACATTGCTTTCACTGTTGCTGTTCTCTTCCATTTTCACATTATCCACGTCAGCCGATA
JMFS056F09+ CCACATTGCTTTCACTGTTGCTGTTCTCTTCCATTTTCACATTATCCACGTCAGCCGATA
                      ____________________________________________________________
consensus CCACATTGCTTTCACTGTTGCTGTTCTCTTCCATTTTCACATTATCCACGTCAGCCGATA
 
. : . : . : . : . : . :
JMFS049B02+ CTTGGGTATCTTCTGATAATGCCTCAGCAACCTGTAACTGATCAGTTGAAAACGATGATC
JMFS169E12+ CTTGGGTATCTTCTGATAATGCCTCAGCAACCTGTAACTGATCAGTTGAAAACGATGATC
JMFS154D06+ CTTGGGTATCTTCTGATAATGCCTCAGCAACCTGTAACTGATCAGTTGAAAACGATGATC
JMFS050E11+ CTTGGGTATCTTCTGATAATGCCTCAGCAACCTGTAACTGATCAGTTGAAAACGATGATC
JMFS050F03+ CTTGGGTATCTTCTGATAATGCCTCAGCAACCTGTAACTGATCAGTTGAAAACGATGATC
JMFS015G03+ CTTGGGTATCTTCTGATAATGCCTCAGCAACCTGTAACTGATCAGTTGAAAACGATGATC
JMSF004H07+ TCTGATAATGCCTCAGCAACCTGTAACTGATCAGTTGAAAACGATGATC
JMFS008E05+ CTTGGGTATCTTCTGATAATGCCTCAGCAACCTGTAACTGATCAGTTGAAAACGATGATC
JMFS056F09+ CTTGGGTATCTTCTGATAATGCCTCAGCAACCTGTAACTGATCAGTTGAAAACGATGATC
                      ____________________________________________________________
consensus CTTGGGTATCTTCTGATAATGCCTCAGCAACCTGTAACTGATCAGTTGAAAACGATGATC
 
. : . : . : . : . : . :
JMFS049B02+ CCTCGCCCTCGCCACCAGGAACAAGGACCTTCTCTGATGCTGCAACTCTAAAAGAAGAGG
JMFS169E12+ CCTCGCCCTCGCCACCAGGAACAAGGACCTTCTCTGATGCTGCAACTCTAAAAGAAGAGG
JMFS154D06+ CCTCGCCCTCGCCACCAGGAACAAGGACCTTCTCTGATGCTGCAACTCTAAAAGAAGAGG
JMFS050E11+ CCTCGCCCTCGCCACCAGGAACAAGGACCTTCTCTGATGCTGCAACTCTAAAAGAAGAGG
JMFS050F03+ CCTCGCCCTCGCCACCAGGAACAAGGACCTTCTCTGATGCTGCAACTCTAAAAGAAGAGG
JMFS015G03+ CCTCGCCCTCGCCACCAGGAACAAGGACCTTCTCTGATGCTGCAACTCTAAAAGAAGAGG
JMSF004H07+ CCTCGCCCTCGCCACCAGGAACAAGGACCTTCTCTGATGCTGCAACTCTAAAAGAAGAGG
JMFS008E05+ CCTCGCCCTCGCCACCAGGAACAAGGACCTTCTCTGATGCTGCAACTCTAAAAGAAGAGG
JMFS056F09+ CCTCGCCCTCGCCACCAGGAACAAGGACCTTCTCTGATGCTGCAACTCTAAAAGAAGAGG
                      ____________________________________________________________
consensus CCTCGCCCTCGCCACCAGGAACAAGGACCTTCTCTGATGCTGCAACTCTAAAAGAAGAGG
 
. : . : . : . : . : . :
JMFS049B02+ GTTCGGATTCATGTGAAGTATTTCCGGCAAAGATCTTCCATGAAGAAAACGAATTCCTTT
JMFS169E12+ GTTCGGATTCATGTGAAGTATTTCCGGCAAAGATCTTCCATGAAGAAAACGAATTCCTTT
JMFS154D06+ GTTCGGATTCATGTGAAGTATTTCCGGCAAAGATCTTCCATGAAGAAAACGAATTCCTTT
JMFS050E11+ GTTCGGATTCATGTGAAGTATTTCCGGCAAAGATCTTCCATGAAGAAAACGAATTCCTTT
JMFS050F03+ GTTCGGATTCATGTGAAGTATTTCCGGCAAAGATCTTCCATGAAGAAAACGAATTCCTTT
JMFS015G03+ GTTCGGATTCATGTGAAGTATTTCCGGCAAAGATCTTCCATGAAGAAAACGAATTCCTTT
JMSF004H07+ GTTCGGATTCATGTGAAGTATTTCCGGCAAAGATCTTCCATGAAGAAAACGAATTCCTTT
JMFS008E05+ GTTCGGATTCATGTGAAGTATTTCCGGCAAAGATCTTCCATGAAGAAAACGAATTCCTTT
JMFS056F09+ GTTCGGATTCATGTGAAGTATTTCCGGCAAAGATCTTCCATGAAGAAAACGAATTCCTTT
                      ____________________________________________________________
consensus GTTCGGATTCATGTGAAGTATTTCCGGCAAAGATCTTCCATGAAGAAAACGAATTCCTTT
 
. : . : . : . : . : . :
JMFS049B02+ TCAGAGCGAGAGTGGGGTTGGCATTCCGCCGATCAGCGTTCGAGGTCGATCCGAGATGCT
JMFS169E12+ TCAGAGCGAGAGTGGGGTTGGCATTCCGCCGATCAGCGTTCGAGGTCGATCCGAGATGCT
JMFS154D06+ TCAGAGCGAGAGTGGGGTTGGCATTCCGCCGATCAGCGTTCGAGGTCGATCCGAGATGCT
JMFS050E11+ TCAGAGCGAGAGTGGGGTTGGCATTCCGCCGATCAGCGTTCGAGGTCGATCCGAGATGCT
JMFS050F03+ TCAGAGCGAGAGTGGGGTTGGCATTCCGCCGATCAGCGTTCGAGGTCGATCCGAGATGCT
JMFS015G03+ TCAGAGCGAGAGTGGGGTTGGCATTCCGCCGATCAGCGTTCGAGGTCGATCCGAGATGCT
JMSF004H07+ TCAGAGCGAGAGTGGGGTTGGCATTCCGCCGATCAGCGTTCGAGGTCGATCCGAGATGCT
JMFS008E05+ TCAGAGCGAGAGTGGGGTTGGCATTCCGCCGATCAGCGTTCGAGGTCGATCCGAGATGCT
JMFS056F09+ TCAGAGCGAGAGTGGGGTTGGCATTCCGCCGATCAGCGTTCGAGGTCGATCCGAGATGCT
                      ____________________________________________________________
consensus TCAGAGCGAGAGTGGGGTTGGCATTCCGCCGATCAGCGTTCGAGGTCGATCCGAGATGCT
 
. : . : . : . : . : . :
JMFS049B02+ TGTAAACCGGCGCAACAGCAGGCAAACGGAGGCCGGAGAGGGTGTAAACCATATCTCTCT
JMFS169E12+ TGTAAACCGGCGCAACAGCAGGCAAACGGAGGCCGGAGAGGGTGTAAACCATATCTCTCT
JMFS154D06+ TGTAAACCGGCGCAACAGCAGGCAAACGGAGGCCGGAGAGGGTGTAAACCATATCTCTCT
JMFS050E11+ TGTAAACCGGCGCAACAGCAGGCAAACGGAGGCCGGAGAGGGTGTAAACCATATCTCTCT
JMFS050F03+ TGTAAACCGGCGCAACAGCAGGCAAACGGAGGCCGGAGAGGGTGTAAACCATATCTCTCT
JMFS015G03+ TGTAAACCGGCGCAACAGCAGGCAAACGGAGGCCGGAGAGGGTGTAAACCATATCTCTCT
JMSF004H07+ TGTAAACCGGCGCAACAGCAGGCAAACGGAGGCCGGAGAGGGTGTAAACCATATCTCTCT
JMFS008E05+ TGTAAACCGGCGCAACAGCAGGCAAACGGAGGCCGGAGAGGGTGTAAACCATATCTCTCT
JMFS056F09+ TGTAAACCGGCGCAACAGCAGGCAAACGGAGGCCGGAGAGGGTGTAAACCATATCTCTCT
                      ____________________________________________________________
consensus TGTAAACCGGCGCAACAGCAGGCAAACGGAGGCCGGAGAGGGTGTAAACCATATCTCTCT
 
. : . : . : . : . : . :
JMFS049B02+ GCCTTCAATTTCCGAATCTGGAAAGAATTGAATCGAGAAAGAGAAGAATGCGGGCGGAAT
JMFS169E12+ GCCTTCAATTTCCGAATCTGGAAAGAATTGAATCGAGAAAGAGAAGAATGCGGGCGGAAT
JMFS154D06+ GCCTTCAATTTCCGAATCTGGAAAGAATTGAATCGAGAAAGAGAAGAATGCGGGCGGAAT
JMFS050E11+ GCCTTCAATTTCCGAATCTGGAAAGAATTGAATCGAGAAAGAGAAGAATGCGGGCGGAAT
JMFS050F03+ GCCTTCAATTTCCGAATCTGGAAAGAATTGAATCGAGAAAGAGAAGAATGCGGGCGGAAT
JMFS015G03+ GCCTTCAATTTCCGAATCTGGAAAGAATTGAATCGAGAAAGAGAAGAATGCGGGCGGAAT
JMSF004H07+ GCCTTCAATTTCCGAATCTGGAAAGAATTGAATCGAGAAAGAGAAGAATGCGGGCGGAAT
JMFS008E05+ GCCTTCAATTTCCGAATCTGGAAAGAATTGAATCGAGAAAGAGAAGAATGCGGGCGGAAT
JMFS056F09+ GCCTTCAATTTCCGAATCTGGAAAGAATTGAATCGAGAAAGAGAAGAATGCGGGCGGAAT
                      ____________________________________________________________
consensus GCCTTCAATTTCCGAATCTGGAAAGAATTGAATCGAGAAAGAGAAGAATGCGGGCGGAAT
 
. : . : . : . : . : . :
JMFS049B02+ CGTTTGCTCCTTTCACAAAATCTGC
JMFS169E12+ CGTTTGCTCCTTTCACAAAATCTGCTGACTTACACTCTCAAAG
JMFS154D06+ CGTTTGCTCCTTTCACAAAATCTGCTGACTTACACTCTCAAAG
JMFS050E11+ CGTTTGCTCCTTTCACAAAATCTGCTGA
JMFS050F03+ CGTTTGCTCCTTTCACAAAATCTGCTGA
JMFS015G03+ CGTTTGCTCCT
JMSF004H07+ CGTTTGCTCCTTTCACAAAATCTGCTGACTTACACTCTC
JMFS008E05+ CGTTTGCTCCTTTCACAAAATCTGCTGACTTACACTCTCAAAGTGGTGATTAG
JMFS056F09+ CGTTTGCTCCTTTCACAAAATCTGCTGACTTACACTCTCAAAGTGGTGATTAGCAATTGC
                      ____________________________________________________________
consensus CGTTTGCTCCTTTCACAAAATCTGCTGACTTACACTCTCAAAGTGGTGATTAGCAATTGC