Previous Contig 003333:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005H06Sequence712003333 (30)gb:AF190656_17754396e-54Nicotiana tabacum clone 1 poly(A)-binding protein (PABP1) mRNA, partial cds.
JMFF021M15Sequence167005701 (5)557003333 (30)gb:AF190656_17754391e-55Nicotiana tabacum clone 1 poly(A)-binding protein (PABP1) mRNA, partial cds.
JMFF047N02Sequence625003333 (30)gb:AF190655_17754383e-33Nicotiana tabacum poly(A)-binding protein (PABP) mRNA, complete cds.525003333 (30)gb:AF190656_17754392e-49Nicotiana tabacum clone 1 poly(A)-binding protein (PABP1) mRNA, partial cds.
JMFN020N05Sequence582003333 (30)gb:AF190656_17754391e-59Nicotiana tabacum clone 1 poly(A)-binding protein (PABP1) mRNA, partial cds.
JMFN030F05Sequence559003333 (30)gb:AF190656_17754391e-59Nicotiana tabacum clone 1 poly(A)-binding protein (PABP1) mRNA, partial cds.
JMFN031K23Sequence629003333 (30)gb:AF190656_17754393e-47Nicotiana tabacum clone 1 poly(A)-binding protein (PABP1) mRNA, partial cds.
JMFN034G13Sequence632003333 (30)gb:AF190656_17754398e-70Nicotiana tabacum clone 1 poly(A)-binding protein (PABP1) mRNA, partial cds.
JMFN043E03Sequence554003333 (30)gb:AF190656_17754394e-53Nicotiana tabacum clone 1 poly(A)-binding protein (PABP1) mRNA, partial cds.
JMFS012G03Sequence623003333 (30)gb:AF190655_17754381e-40Nicotiana tabacum poly(A)-binding protein (PABP) mRNA, complete cds.
JMFS033G01Sequence617003333 (30)gb:AF190655_17754381e-37Nicotiana tabacum poly(A)-binding protein (PABP) mRNA, complete cds.
JMFS037H07Sequence586003333 (30)gb:AF190655_17754383e-64Nicotiana tabacum poly(A)-binding protein (PABP) mRNA, complete cds.
JMFS045H07Sequence601003333 (30)gb:AF190655_17754388e-31Nicotiana tabacum poly(A)-binding protein (PABP) mRNA, complete cds.
JMFS055H09Sequence627003333 (30)gb:AF190655_17754388e-30Nicotiana tabacum poly(A)-binding protein (PABP) mRNA, complete cds.
JMFS070C05Sequence621003333 (30)gb:AF190655_17754385e-38Nicotiana tabacum poly(A)-binding protein (PABP) mRNA, complete cds.
JMFS097B07Sequence615003333 (30)gb:AF190655_17754381e-34Nicotiana tabacum poly(A)-binding protein (PABP) mRNA, complete cds.
JMFS108B12Sequence627003333 (30)gb:AF190655_17754382e-41Nicotiana tabacum poly(A)-binding protein (PABP) mRNA, complete cds.
JMFS115D11Sequence627003333 (30)gb:AF190655_17754382e-38Nicotiana tabacum poly(A)-binding protein (PABP) mRNA, complete cds.
JMFS126A10Sequence639003333 (30)gb:AF190655_17754389e-43Nicotiana tabacum poly(A)-binding protein (PABP) mRNA, complete cds.
JMFS129A03Sequence626003333 (30)gb:AF190655_17754386e-41Nicotiana tabacum poly(A)-binding protein (PABP) mRNA, complete cds.
JMFS149A06Sequence620003333 (30)gb:AF190656_17754395e-62Nicotiana tabacum clone 1 poly(A)-binding protein (PABP1) mRNA, partial cds.
JMFS154F08Sequence616003333 (30)gb:AF190655_17754382e-35Nicotiana tabacum poly(A)-binding protein (PABP) mRNA, complete cds.
JMFS156G02Sequence612003333 (30)gb:AF190655_17754381e-34Nicotiana tabacum poly(A)-binding protein (PABP) mRNA, complete cds.
JMFS168H02Sequence622003333 (30)gb:AF190655_17754383e-37Nicotiana tabacum poly(A)-binding protein (PABP) mRNA, complete cds.
JMSF005C18Sequence137003333 (30)
JMSF017K12Sequence171005701 (5)690003333 (30)gb:AF190656_17754396e-56Nicotiana tabacum clone 1 poly(A)-binding protein (PABP1) mRNA, partial cds.
JMSF026G11Sequence171005701 (5)742003333 (30)gb:AF190656_17754393e-58Nicotiana tabacum clone 1 poly(A)-binding protein (PABP1) mRNA, partial cds.
JMSF029A05Sequence172005701 (5)699003333 (30)gb:AF190656_17754393e-56Nicotiana tabacum clone 1 poly(A)-binding protein (PABP1) mRNA, partial cds.
JMSF045I14Sequence811003333 (30)gb:AF190655_1775438e-126Nicotiana tabacum poly(A)-binding protein (PABP) mRNA, complete cds.690003333 (30)gb:AF190656_17754392e-58Nicotiana tabacum clone 1 poly(A)-binding protein (PABP1) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN043E03+ AATG
                      ____________________________________________________________
consensus AATG
 
. : . : . : . : . : . :
rJMFF047N02- CCAAAGAATTCATAGTAGACTAAATGTCCTCAAGCCCACGCAAACAAAG-TCT
JMFN043E03+ TTTCAAACCAAAGAATTCATAGTAGACTAAATGTCCTCAAGCCCACGCAAACAAAG-TCT
rJMSF045I14- TC-AGCCCACGCAAACAAAGTTCT
rJMFF021M15- AATGTCCTCAAGCCCACGCAAACAAAG-TCT
rJMFF005H06- AATGTCCTCAAGCCCACGCAAACAAAG-TCT
rJMSF029A05- TC-AGCCCACGCAAACNAAG-TCT
rJMSF017K12- TC-AGCCCACGCAAACAAAG-TCT
rJMSF026G11- TC-AGCCCACGCAAACAAAG-TCT
                      ____________________________________________________________
consensus TTTCAAACCAAAGAATTCATAGTAGACTAAATGTCCTCAAGCCCACGCAAACAAAG-TCT
 
. : . : . : . : . : . :
rJMFF047N02- ATGCAGAATATGAAACCAACATTATCCGCAACACAAATTCAGAAGTTCATCAGAAAAGGA
JMFN043E03+ ATGCAGAATATGAAACCAACATTATCCGCAACACAAATTCAGAAGTTCATCAGAAAAGGA
rJMSF045I14- ATGCAGAATATGAAACCAACATTATCCGCAACACAAATTCAGAAGTTCATCAGAAAAGGA
rJMFF021M15- ATGCAGAATATGAAACCAACATTATCCGCAACACAAATTCAGAAGTTCATCAGAAAAGGA
rJMFF005H06- ATGCAGAATATGAAACCAACATTATCCGCAACACAAATTCAGAAGTTCATCAGAAAAGGA
rJMSF029A05- ATGCAGAATATGAAACCAACATTATCCGCAACACAAATTCAGAAGTTCATCAGAAAAGGA
rJMSF017K12- ATGCAGAATATGAAACCAACATTATCCGCAACACAAATTCAGAAGTTCATCAGAAAAGGA
JMFN030F05+ ACCAACATTATCCGCAACACAAATTCAGAAGTTCATCAGAAAAGGA
rJMSF026G11- ATGCAGAATATGAAACCAACATTATCCGCAACACAAATTCAGAAGTTCATCAGAAAAGGA
                      ____________________________________________________________
consensus ATGCAGAATATGAAACCAACATTATCCGCAACACAAATTCAGAAGTTCATCAGAAAAGGA
 
. : . : . : . : . : . :
rJMFF047N02- AATAATAGTATGTGTGTGTTTTTTTTTTAATCCCAAAATAACCACTACCAAGTACCAACC
JMFN043E03+ AATAATAGTATGTGTGTGTTTTTTTTTTAATCCCAAAATAACCACTACCAAGTACCAACC
rJMSF045I14- AATAATAGTATGTGTGTGTTTTTTTTTTAATCCCAAAATAACCACTACCAAGTACCAACC
rJMFF021M15- AATAATAGTATGTGTGTGTTTTTTTTTTAATCCCAAAATAACCACTACCAAGTACCAACC
rJMFF005H06- AATAATAGTATGTGTGTGTTTTTTTTTTAATCCCAAAATAACCACTACCAAGTACCAACC
rJMSF029A05- AATAATAGTATGTGTGTGTTTTTTTTTTAATCCCNAAATAACCACTACCAAGTACCAACC
rJMSF017K12- AATAATAGTATGTGTGTGTTTTTTTTTTAATCCCAAAATAACCACTACCAAGTACCAACC
JMFN020N05+ TTTTTTTTAATCCCAAAATAACCACTACCAAGTACCAACC
JMFN030F05+ AATAATAGTATGTGTGTG--TTTTTTTTAATCCCAAAATAACCACTACCAAGTACCAACC
rJMSF026G11- AATAATAGTATGTGTGTGTTTTTTTTTTAATCCCAAAATAACCACTACCAAGTACCAACC
                      ____________________________________________________________
consensus AATAATAGTATGTGTGTGTTTTTTTTTTAATCCCAAAATAACCACTACCAAGTACCAACC
 
. : . : . : . : . : . :
rJMFF047N02- AGCCCACTCAAGAAACTAGACCATCATTCAATGACAATGAAGCAAGTTGATCAGCAGGGT
JMFN043E03+ AGCCCACTCAAGAAACTAGACCATCATTCAATGACAATGAAGCAAGTTGATCAGCAGGGT
rJMSF045I14- AGCCCACTCAAGAAACTAGACCATCATTCAATGACAATGAAGCAAGTTGATCAGCAGGGT
rJMFF021M15- AGCCCACTCAANAAACTANACCATCATTCAATGACAATGAAGCAAGTTGATCAGCAGGGT
rJMFF005H06- AGCCCACTCAAGAAACTANACCATCNTTCAATGACAATGAAGCAAGTTGATCANCAGGGT
rJMSF029A05- AGCCCACTCAAGAAACTAGACCATCATTCAATGACAATGAAGCAAGTTGATCAGCAGGGT
rJMSF017K12- AGCCCACTCAAGAAACTAGACCATCATTCAATGACAATGAAGCAAGTTGATCAGCAGGGT
JMFN020N05+ AGCCCACTCAAGAAACTAGACCATCATTCAATGACAATGAAGCAAGTTGATCAGCAGGGT
JMFN030F05+ AGCCCACTCAAGAAACTAGACCATCATTCAATGACAATGAAGCAAGTTGATCAGCAGGGT
rJMSF026G11- AGCCCACTCAAGAAACTAGACCATCATTCAATGACAATGAAGCAAGTTGATCAGCAGGGT
JMFN034G13+ CATCATTCAATGACAATGAAGCAAGTTGATCAGCAGGGT
                      ____________________________________________________________
consensus AGCCCACTCAAGAAACTAGACCATCATTCAATGACAATGAAGCAAGTTGATCAGCAGGGT
 
. : . : . : . : . : . :
rJMFF047N02- TGTTTGACTGCTGCTGAGAAACATTCCTCAGGACATCCATGGCCTCTGCAACCTTGGATT
JMFN043E03+ TGTTTGACTGCTGCTGAGAAACATTCCTCAGGACATCCATGGCCTCTGCAACCTTGGATT
rJMSF045I14- TGTTTGACTGCTGCTGANAAACATTCCTCAGGACATCCATGGCCTCTGCAACCTTGGATT
rJMFF021M15- TGTTTGACTGCTGCTGAAAAACATTCCTCAGGACATCCATGGCCTCTGCAACCTTGGATT
rJMFF005H06- TGTTTGACTGCTGCTGANAAACATTCCTCAGGACATCCATGGCCTCTGCAACCTTGGATT
rJMSF029A05- TGTTTGACTGCTGCTGANAAACATTCCTCAGGACATCCATGGCCTCTGCAACCTTGGATT
rJMSF017K12- TGTTTGACTGCTGCTGANAAACATTCCTCAGGACATCCATGCCCTCTGCAACCTTGGATT
JMFN020N05+ TGTTTGACTGCTGCTGAGAAACATTCCTCAGGACATCCATGGCCTCTGCAACCTTGGATT
JMFN030F05+ TGTTTGACTGCTGCTGAGAAACATTCCTCAGGACATCCATGGCCTCTGCAACCTTGGATT
rJMSF026G11- TGTTTGACTGCTGCTGANAAACATTCCTCAGGACATCCATGGCCTCTGCAACCTTGGATT
JMFN034G13+ TGTTTGACTGCTGCTGAGAAACATTCCTCAGGACATCCATGGCCTCTGCAACCTTGGATT
JMFS149A06+ AAACATTCCTCAGGACATCCATGGCCTCTGCAACCTTGGATT
                      ____________________________________________________________
consensus TGTTTGACTGCTGCTGAGAAACATTCCTCAGGACATCCATGGCCTCTGCAACCTTGGATT
 
. : . : . : . : . : . :
rJMFF047N02- TCAGAGCTTCAGGAGACTCAAGCAAATGGAGGACCTCTGTCTGATCCATTTCCAGAAGCA
JMFN043E03+ TCAGAGCTTCAGGAGACTCAAGCAAATGGAGGACCTCTGTCTGATCCATTTCCAGAAGCA
rJMSF045I14- TCANAGCTTCAGGAGACTCAAGCAAATGGAGGACCTCTGTCTGATCCATTTCCAGAAGCA
rJMFF021M15- TCAAAGCTTCAGGANACTCAAGCAAATGGAGGACCTCTGTCTGATCCATTTCCANAAGCA
rJMFF005H06- TCANAGCTTCAGGAGACTCAAGCAAATGGAGGACCTCTGTCTGATCCATTTCCANAAGCA
rJMSF029A05- TCANAGCTTCAGGAGACTCAAGCAAATGGAGGACCTCTGTCTGATCCATTTCCAGAAGCA
rJMSF017K12- TCANAGCTTCAGGAGACTCANGCAAATGGAGGACCTCTGTCTGATCCATTTCCAGAAGCA
JMFN020N05+ TCAGAGCTTCAGGAGACTCAAGCAAATGGAGGACCTCTGTCTGATCCATTTCCAGAAGCA
JMFN030F05+ TCAGAGCTTCAGGAGACTCAAGCAAATGGAGGACCTCTGTCTGATCCATTTCCAGAAGCA
rJMSF026G11- TCANAGCTTCAGGAGACTCAAGCAAATGGAGGACCTCTGTCTGATCCATTTCCAGAAGCA
JMFN034G13+ TCAGAGCTTCAGGAGACTCAAGCAAATGGAGGACCTCTGTCTGATCCATTTCCAGAAGCA
JMFS149A06+ TCAGAGCTTCAGGAGACTCAAGCAAATGGAGGACCTCTGTCTGATCCATTTCCAGAAGCA
                      ____________________________________________________________
consensus TCAGAGCTTCAGGAGACTCAAGCAAATGGAGGACCTCTGTCTGATCCATTTCCAGAAGCA
 
. : . : . : . : . : . :
rJMFF047N02- TGCCAGTCACCTTGGCTGCTGTCTCGGGCTCCAGCTGCTCCACAAGTGGGTATAAATTTT
JMFN043E03+ TGCCAGTCACCTTGGCTGCTGTCTCGGGCTCCAGCTGCTCCACAAGTGGGTATAAATTTT
rJMSF045I14- TGCCAGTCACCTTGGCTGCTGTCTCGGGCTCCAGCTGCTCCACAAGNGGGTATAAATTTT
rJMFF021M15- TGCCAGTCACCTTGGCTGCTGTCTCGGGCTCCAGCTGCTCCACAAGTGGGTATAAATTTT
rJMFF005H06- TGCCAGTCACCTTGGCTGCTGTCTCGGGCTCCAGCTGCTCCACAAGNGGGTATAAATTTT
rJMSF029A05- TGCCAGTCACCTTGGCTGCTGTCTCGGGCTCCAGCTGCTCCACAAGTGGGTATAAATTTT
rJMSF017K12- TGCCAGTCACCTTGGCTGCTGTCTCGGGCTCCAGCTGCTCCACAAGNGGGTATAAATTTT
JMFN020N05+ TGCCAGTCACCTTGGCTGCTGTCTCGGGCTCCAGCTGCTCCACAAGTGGGTATAAATTTT
JMFN030F05+ TGCCAGTCACCTTGGCTGCTGTCTCGGGCTCCAGCTGCTCCACAAGTGGGTATAAATTTT
rJMSF026G11- TGCCAGTCACCTTGGCTGCTGTCTCGGGCTCCAGCTGCTCCACAAGTGGGTATAAATTTT
JMFN034G13+ TGCCAGTCACCTTGGCTGCTGTCTCGGGCTCCAGCTGCTCCACAAGTGGGTATAAATTTT
JMFS149A06+ TGCCAGTCACCTTGGCTGCTGTCTCGGGCTCCAGCTGCTCCACAAGTGGGTATAAATTTT
                      ____________________________________________________________
consensus TGCCAGTCACCTTGGCTGCTGTCTCGGGCTCCAGCTGCTCCACAAGTGGGTATAAATTTT
 
. : . : . : . : . : . :
rJMFF047N02- CGCCCAACATCGTTCTTTGTTCAGTAGGAGAAGCATTAGCAAGTGCAGATGCTAAAGCCC
JMFN043E03+ CGCCCAACATCGTTCTTTGTTCAGTAGGAGAAGCATTAGCAAGTGCAGATGCTAAAGCCC
rJMSF045I14- CGCCCAACATCGTTCTTTGTTCAGTAGGAGAAGCATTAGCAAGTGCAGATGCTAAAGCCC
rJMFF021M15- CNCCCAACATCGTTCTTTGTTCAGTAGGANAAGCATTANCAAGTGCANATGCTAAAGCCC
rJMFF005H06- CNCCCAACATCGTTCTTTGTTCAGTAGGANAAGCATTANCAAGTGCACATGCTAAAGCCC
rJMSF029A05- CGCCCAACATCGTTCTTTGTTCAGTAGGAGAANCNTTANCAAGTGCANATGCTAAAGCCC
rJMSF017K12- CGCCCAACATCGTTCTTTGTTCAGTAGGAGAAGCATTANCAAGNGCANATGCTAAAGCCC
JMFN020N05+ CGCCCAACATCGTTCTTTGTTCAGTAGGAGAAGCATTAGCAAGTGCAGATGCTAAAGCCC
JMFN030F05+ CGCCCAACATCGTTCTTTGTTCAGTAGGAGAAGCATTAGCAAGTGCAGATGCTAAAGCCC
rJMSF026G11- CGCCCAACATCGTTCTTTGTTCAGTAGGAGAAGCATTAGCAAGTGCANATGCTAAAGCCC
JMFN034G13+ CGCCCAACATCGTTCTTTGTTCAGTAGGAGAAGCATTAGCAAGTGCAGATGCTAAAGCCC
JMFS149A06+ CGCCCAACATCGTTCTTTGTTCAGTAGGAGAAGCATTAGCAAGTGCAGATGCTAAAGCCC
JMFN031K23+ CATTAGCAAGTGCAGATGCTAAAGCCN
                      ____________________________________________________________
consensus CGCCCAACATCGTTCTTTGTTCAGTAGGAGAAGCATTAGCAAGTGCAGATGCTAAAGCCC
 
. : . : . : . : . : . :
rJMFF047N02- CAATTGGCATTGGCTGAGCCATTCCTGGATCACGCACAGGCATAACACCCATA
JMFN043E03+ CAATTGGCATTGGCTGAGCCATTCCTGGATCACGCACAGGCATAACACCCATATCATATG
rJMSF045I14- CAATTGGCATTGGCTGAGCCATTCCTGGATCACGCACAGGCATAACACCCATATCATATG
rJMFF021M15- CAATTGGCATTGGCTGAGCCATACCTGGATCACGCACAGGCATAACACCCATATCATATG
rJMFF005H06- CAATTGGCATTGGCTGAGCCATTCCTGGATCACGCACAGGCATAACACCCATATCATATG
rJMSF029A05- CAATTGGCATTGGCTGANCCATTCCTGGATCACGCACAGGCATANCACCCATATCATATG
rJMSF017K12- CAATTGGCATTGGCTGAGCCATTCCNGGATCACGCACAGGCATAACACCCATATCATATG
JMFN020N05+ CAATTGGCATTGGCTGAGCCATTCCTGGATCACGCACAGGCATAACACCCATATCATATG
JMFN030F05+ CAATTGGCATTGGCTGAGCCATTCCTGGATCACGCACAGGCATAACACCCATATCATATG
rJMSF026G11- CAATTGGCATTGGCTGAGCCATTCCTGGATCACGCACAGGCATAACACCCATATCATATG
JMFN034G13+ CAATTGGCATTGGCTGAGCCATTCCTGGATCACGCACAGGCATAACACCCATATCATATG
JMFS149A06+ CAATTGGCATTGGCTGAGCCATTCCTGGATCACGCACAGGCATAACACCCATATCATATG
JMFN031K23+ CAATTGGCATTGGCTGAGCCATTCCTGGATCACGCACAGGCATAACACCCATATCATATG
                      ____________________________________________________________
consensus CAATTGGCATTGGCTGAGCCATTCCTGGATCACGCACAGGCATAACACCCATATCATATG
 
. : . : . : . : . : . :
JMFN043E03+ GGACAGAGAAC
rJMSF045I14- GGACAGAGAACATGCCCCCAGCTACACCA-GGAATAGAAACATCAGGGAGACCACGTCCT
rJMFF021M15- GGACAGAGAACATGCCCCCAGCTACACCAGGGAATANAAACATCAGG
rJMFF005H06- GGACANANAACATGCCCCCAGCTACACCA-GGAATANAAACATCAGGGAGACCACGTCCT
rJMSF029A05- GGACAGAGAACNTGCCCCCNGCTACACCA-GGAATAGAAACATCAGGGAGACCACGTCCT
rJMSF017K12- GGACAGANAACATGCCCCCAGCTACNCCA-GGAATAGAAACATCAGGGAGACCACGTCCN
JMFN020N05+ GGACAGAGAACATGCCCCCAGCTACACCA-GGAATAGAAACATCAGGGAGACCACGTCCT
JMFN030F05+ GGACAGAGAACATGCCCCCAGCTACACCA-GGAATAGAAACATCAGGGAGACCACGTCCT
rJMSF026G11- GGACAGAGAACATGCCCCCAGCTACACCA-GGAATAGAAACATCAGGGAGACCACGTCCT
JMFN034G13+ GGACAGAGAACATGCCCCCAGCTACACCA-GGAATAGAAACATCAGGGAGACCACGTCCT
JMFS149A06+ GGACAGAGAACATGCCCCCAGCTACACCA-GGAATAGAAACATCAGGGAGACCACGTCCT
JMFN031K23+ GGACAGAGAACATGCCCCCAGCTACACCA-GGAATAGAAACATCAGGGAGACCACGTCCT
                      ____________________________________________________________
consensus GGACAGAGAACATGCCCCCAGCTACACCA-GGAATAGAAACATCAGGGAGACCACGTCCT
 
. : . : . : . : . : . :
rJMSF045I14- GTAGGATAACGATACCCACGTCCCCTTGGAAGCATCTGCTGCTGCATCATTGGAACTGGT
rJMFF005H06- GTAGGATAACGATACCCACGTCCCCTTGGAAGCATCTGCTGCTGCATCATTGGAACTGGT
rJMSF029A05- GTAGGATAACGATACCCACGTCCCCTTGGAAGCATCTGCTGCTGCATCATTGGAACTGGT
rJMSF017K12- GTAGGATAACGATACCCACGTCCCCTTGGAAGCATCTGCTGCTGCATCATTGGAACTGGT
JMFN020N05+ GTAGGATAACGATACCCACGTCCCCTTGGAAGCATCTGCTGCTGCATCATTGGAACTGGT
JMFN030F05+ GTAGGATAACGATACCCACGTCCCC-TGGAAGCATCT
rJMSF026G11- GTAGGATAACGATACCCACGTCCCCTTGGAAGCATCTGCTGCTGCATCATTGGAACTGGT
JMFN034G13+ GTAGGATAACGATACCCACGTCCCCTTGGAAGCATCTGCTGCTGCATCATTGGAACTGGT
JMFS149A06+ GTAGGATAACGATACCCACGTCCCCTTGGAAGCATCTGCTGCTGCATCATTGGAACTGGT
JMFN031K23+ GTAGGATAACGATACCCACGTCCCCTTGGAAGCATCTGCTGCTGCATCATTGGAACTGGT
                      ____________________________________________________________
consensus GTAGGATAACGATACCCACGTCCCCTTGGAAGCATCTGCTGCTGCATCATTGGAACTGGT
 
. : . : . : . : . : . :
rJMSF045I14- TGCTGCCCCTGCTGAAATGGACCAGACCCTCCACGTCTGCCACCAGGACGCTGACCTTGC
rJMFF005H06- TGCTGCCCCTGCTGCAATGGACCAAANCCTCCACGTCTGCCACCAGGACGCTGACCTTGC
rJMSF029A05- TGCTGCCCCTGCTGCAATGGACCAAACCCTCCACGTCTGCCACCAGGACGCTGACCTTGC
rJMSF017K12- TGCTGCCCCTGCTGCAATGGACCANACCCTCCACGTCTGCCACCAGGACGCTGACCTTGC
JMFN020N05+ TGCTGCCCCTGCTGCAATGGACCAGACCCTCCACGTCTGCCACCAGGACG
rJMSF026G11- TGCTGCCCCTGCTGCAATGGACCAGACCCTCCACGTCTGCCACCAGGACGCTGACCTTGC
JMFN034G13+ TGCTGCCCCTGCTGCAATGGACCAGACCCTCCACGTCTGCCACCAGGACGCTGACCTTGC
JMFS149A06+ TGCTGCCCCTGCTGCAATGGACCAGACCCTCCACGTCTGCCACCAGGACGCTGACCTTGC
JMFN031K23+ TGCTGCCCCTGCTGCAATGGACCAGACCCTCCACGTCTGCCACCAGGACGCTGACCTTGC
                      ____________________________________________________________
consensus TGCTGCCCCTGCTGCAATGGACCAGACCCTCCACGTCTGCCACCAGGACGCTGACCTTGC
 
. : . : . : . : . : . :
rJMSF045I14- TGAC
rJMFF005H06- TGACCTTGCTGAACAA
rJMSF029A05- TGACCTTGCTGAACA
rJMSF017K12- TGACCTTGC
rJMSF026G11- TGACCTTGCTGAACAAGTGGCATAAAGAAATTTGGCATATGTGCCCCCCCAGGCCTCA
JMFN034G13+ TGACCTTGCTGAACAAGTGGCATAAAGAAATTTGGCATATGTGCCCCCCCAGGCCTCATA
JMFS149A06+ TGACCTTGCTGAACAAGTGGCATAAAGAAATTTGGCATATGTGCCCCCCCAGGCCTCATA
JMFN031K23+ TGACCTTGCTGAACAAGTGGCATAAAGAAATTTGGCATATGTGCCCCCCCAGGCCTCATA
                      ____________________________________________________________
consensus TGACCTTGCTGAACAAGTGGCATAAAGAAATTTGGCATATGTGCCCCCCCAGGCCTCATA
 
. : . : . : . : . : . :
JMFN034G13+ CCTGGGACAAGCTGCTGTTGATACCCAAAACCAGGTTGAGGAGGAAGCAGAGCA
JMFS149A06+ CCTGGGACAAGCTGCTGTTGATACCCAAAACCAGGTTGAGGAGGAAGCAGAGCAGGTGGA
JMFN031K23+ CCTGGGACAAGCTGCTGTTGATACCCAAAACCAGGTTGAGGAGGAAGCAGAGCAGGTGGA
                      ____________________________________________________________
consensus CCTGGGACAAGCTGCTGTTGATACCCAAAACCAGGTTGAGGAGGAAGCAGAGCAGGTGGA
 
. : . : . : . : . : . :
JMFS149A06+ GGCTGTCCATAGAATATTTGTTGCCCTAAACCTGGACCA
JMFN031K23+ GGCTGTCCATAGAATATTTGTTGCCCTAAACCTGGACCACCAGGGGGATACATTGGCATA
                      ____________________________________________________________
consensus GGCTGTCCATAGAATATTTGTTGCCCTAAACCTGGACCACCAGGGGGATACATTGGCATA
 
. : . : . : . : . : . :
JMFN031K23+ CGAGTACCAACTTGAGGTGTTATTGCAATTGGCCGCATCTGAGCAAATTGAGCCTGTAAC
                      ____________________________________________________________
consensus CGAGTACCAACTTGAGGTGTTATTGCAATTGGCCGCATCTGAGCAAATTGAGCCTGTAAC
 
. : . : . : . : . : . :
JMFN031K23+ CTTGCTCTTCTCTCTTCTTTTCTTTGTGCAAGGGCAACATAGAGAGGTTTGCCATTGATC
                      ____________________________________________________________
consensus CTTGCTCTTCTCTCTTCTTTTCTTTGTGCAAGGGCAACATAGAGAGGTTTGCCATTGATC
 
. : . : . : . : . : . :
JMFN031K23+ ATCTTACTATTCATCTCAGCCAGAGCTCTAGATGCCTCCTCAGGAGTTGAATATGCAACA
JMSF045I14+ ATCTCAGCCAGAGCTCTAGATGCCTCCTCAGGAGTNGAATATGCAACA
                      ____________________________________________________________
consensus ATCTTACTATTCATCTCAGCCAGAGCTCTAGATGCCTCCTCAGGAGTTGAATATGCAACA
 
. : . : . : . : . : . :
JMFN031K23+ AAA
JMSF045I14+ AAAGCCGATCCCTTGCTTACTCCATTAGGGTCTCGCATAACCTTGTATGAAGTTATGGTA
                      ____________________________________________________________
consensus AAAGCCGATCCCTTGCTTACTCCATTAGGGTCTCGCATAACCTTGTATGAAGTTATGGTA
 
. : . : . : . : . : . :
JMSF045I14+ CCAAATGGAGAGAATAATTCCTTGAGTTTCTCATCACCAATAGTATCATCAAGATTTTTT
                      ____________________________________________________________
consensus CCAAATGGAGAGAATAATTCCTTGAGTTTCTCATCACCAATAGTATCATCAAGATTTTTT
 
. : . : . : . : . : . :
JMSF045I14+ ATATAGAGATTTGAACCTTGTGACTTGTCAACTGCCTCTTTTGCAGTCTGCTCAAAACGA
                      ____________________________________________________________
consensus ATATAGAGATTTGAACCTTGTGACTTGTCAACTGCCTCTTTTGCAGTCTGCTCAAAACGA
 
. : . : . : . : . : . :
JMSF045I14+ TGTTTTAATTCAAGCTCTCTCTCAGCTTTCTTCTGAGCTTTTCCCACATACCACTCTCTG
                      ____________________________________________________________
consensus TGTTTTAATTCAAGCTCTCTCTCAGCTTTCTTCTGAGCTTTTCCCACATACCACTCTCTG
 
. : . : . : . : . : . :
JMSF045I14+ TTATCAAATTTGTGGCCATTAAGCACTTCCACAGATCTAGCCGCATCATCTGTATCCTCA
                      ____________________________________________________________
consensus TTATCAAATTTGTGGCCATTAAGCACTTCCACAGATCTAGCCGCATCATCTGTATCCTCA
 
. : . : . : . : . : . :
JMSF045I14+ AAGTTGACAAATCCAAAACCCTTTGATTTTCCATCTTCATCTCTCATAACAACAACACTA
                      ____________________________________________________________
consensus AAGTTGACAAATCCAAAACCCTTTGATTTTCCATCTTCATCTCTCATAACAACAACACTA
 
. : . : . : . : . : . :
JMSF045I14+ GTGAGTGTTCCAAAATCACCAAAAACTTTCCTAAGGTCATCTTCGGTTGTAGATTCAGAT
                      ____________________________________________________________
consensus GTGAGTGTTCCAAAATCACCAAAAACTTTCCTAAGGTCATCTTCGGTTGTAGATTCAGAT
 
. : . : . : . : . : . :
JMSF045I14+ AAGTTCTTCACAAAGACATTAGTGAATTTTGTCTTCTCCCCAGCCATTTCTCTTTCTTGC
                      ____________________________________________________________
consensus AAGTTCTTCACAAAGACATTAGTGAATTTTGTCTTCTCCCCAGCCATTTCTCTTTCTTGC
 
. : . : . : . : . : . :
JMSF045I14+ TTGCGAACAAAAGGTCCTACATACACTTGTTTGTCATTCAACAGCATACCATTCAGCTTC
                      ____________________________________________________________
consensus TTGCGAACAAAAGGTCCTACATACACTTGTTTGTCATTCAACAGCATACCATTCAGCTTC
 
. : . : . : . : . : . :
JMSF045I14+ TCAATAGCTTTCAGTGCAGCTTCCTCAGTGTCATATTGCACAAATCCATACCCCTTGGAC
JMFS037H07+ CAAATCCATACCCC-TGGAC
                      ____________________________________________________________
consensus TCAATAGCTTTCAGTGCAGCTTCCTCAGTGTCATATTGCACAAATCCATACCCCTTGGAC
 
. : . : . : . : . : . :
JMSF045I14+ TGACCAGTGGCATCTGTTGCCACCTTGCAAGAAAGAATGCTTCCAAATGCAGAAAATGTA
JMFS037H07+ TGACCAGTGGCATCTGTGNCCACC-TGCAAGAAAGAATGCTTCCAAATGCAGAAAATGTA
                      ____________________________________________________________
consensus TGACCAGTGGCATCTGTTGCCACCTTGCAAGAAAGAATGCTTCCAAATGCAGAAAATGTA
 
. : . : . : . : . : . :
JMSF045I14+ TCATGCAGTGCCTTGTGATCAATTGCCTTGTCCAAATTCTTGATAAATATGTTTCCAGCA
JMFS037H07+ TCATGCAGTGCCTTGTGATCAATTGCCTTGTCCAAATTCTTGATAAATATGTTTCCAGCA
                      ____________________________________________________________
consensus TCATGCAGTGCCTTGTGATCAATTGCCTTGTCCAAATTCTTGATAAATATGTTTCCAGCA
 
. : . : . : . : . : . :
JMSF045I14+ CCGCTTTTGCGCATGGTGGGGTCTCGATGGGAATACATTATCC
JMFS037H07+ CCGCTTTTGCGCATGGTGGGGTCTCGATGGGAATACATTATCCGGATGGGC-TTCCCATT
JMFS129A03+ GAATACATTATCCGGATGGGC-TTCCCATT
JMFS033G01+ CGGATGGGCTTTCCCATT
JMFS108B12+ CGATGGGAATACATTATCCGGATGGGC-TTCCCATT
JMFS012G03+ CGATGGGAATACATATCCCGGATGGGC-TTCCCATT
JMFS126A10+ CGATGGGAATACATTATCCGGATGGGC-TTCCCATT
JMFS168H02+ GGC-TTCCCATT
JMFS070C05+ ATGGGC-TTCCCATT
JMFS115D11+ GGATGGGC-TTCCCATT
                      ____________________________________________________________
consensus CCGCTTTTGCGCATGGTGGGGTCTCGATGGGAATACATTATCCGGATGGGC-TTCCCATT
 
. : . : . : . : . : . :
JMFS037H07+ GAGAGGAGTGAAGTTCAGCACCTCCATAGCCCTAGCAGCATCTTGAGGGTTGCCATAGTT
JMFS129A03+ GAGAGGAGTGAAGTTCAGCACCTCCATAGCCCTAGCAGCATCTTGAGGGTTGCCATAGTT
JMFS033G01+ GAGAGGAGTGAAGTTCAGCACCTCCATAGCCCTAGCAGCATCTTGAGGGTTGCCATAGTT
JMFS108B12+ GAGAGGAGTGAAGTTCAGCACCTCCATAGCCCTAGCAGCATCTTGAGGGTTGCCATAGTT
JMFS012G03+ GAGAGGAGTGAAGTTCAGCACCTCCATAGCCCTAGCAGCATCTTGAGGGTTGCCATAGTT
JMFS126A10+ GAGAGGAGTGAAGTTCAGCACCTCCATAGCCCTAGCAGCATCTTGAGGGTTGCCATAGTT
JMFS168H02+ GAGAGGAGTGAAGTTCAGCACCTCCATAGCCCTAGCAGCATCTTGAGGGTTGCCATAGTT
JMFS045H07+ GAGGAGTGAAGTTCAGCACCTCCATAGCCCTAGCAGCATCTTGAGGGTTGCCATAGTT
JMFS070C05+ GAGAGGAGTGAAGTTCAGCACCTCCATAGCCCTAGCAGCATCTTGAGGGTTGCCATAGTT
JMFS115D11+ GAGAGGAGTGAAGTTCAGCACCTCCATAGCCCTAGCAGCATCTTGAGGGTTGCCATAGTT
JMFS154F08+ AGGAGTGAAGTTCAGCACCTCCATAGCCCTAGCAGCATCTTGAGGGTTGCCATAGTT
JMFS156G02+ GGAGTGAAGTTCAGCACCTCCATAGCCCTAGCAGCATCTTGAGGGTTGCCATAGTT
JMFS097B07+ GGAGTGAAGTTCAGCACCTCCATAGCCCTAGCAGCATCTTGAGGGTTGCCATAGTT
JMFF047N02+ AAGTTCAGCACCTCCATAGCCCTAGCAGCATCTTGAGGGTTGCCATAGTT
JMFS055H09+ GCCCTAGCAGCATCTTGAGGGTGNCCATAGTT
                      ____________________________________________________________
consensus GAGAGGAGTGAAGTTCAGCACCTCCATAGCCCTAGCAGCATCTTGAGGGTTGCCATAGTT
 
. : . : . : . : . : . :
JMFS037H07+ CACATAACCGTAACCCAGAGAGCGCTGGCTAGTCAAATCCCTGCAAACCCTAACCGAGAC
JMFS129A03+ CACATAACCGTAACCCAGAGAGCGCTGGCTAGTCAAATCCCTGCAAACCCTAACCGAGAC
JMFS033G01+ CACATAACCGTAACCCAGAGAGCGCTGGCTAGTCAAATCCCTGCAAACCCTAACCGAGAC
JMFS108B12+ CACATAACCGTAACCCAGAGAGCGCTGGCTAGTCAAATCCCTGCAAACCCTAACCGAGAC
JMFS012G03+ CACATAACCGTAACCCAGAGAGCGCTGGCTAGTCAAATCCCTGCAAACCCTAACCGAGAC
JMFS126A10+ CACATAACCGTAACCCAGAGAGCGCTGGCTAGTCAAATCCCTGCAAACCCTAACCGAGAC
JMFS168H02+ CACATAACCGTAACCCAGAGAGCGCTGGCTAGTCAAATCCCTGCAAACCCTAACCGAGAC
JMFS045H07+ CACATAACCGTAACCCAGAGAGCGCTGGCTAGTCAAATCCCTGCAAACCCTAACCGAGAC
JMFS070C05+ CACATAACCGTAACCCAGAGAGCGCTGGCTAGTCAAATCCCTGCAAACCCTAACCGAGAC
JMFS115D11+ CACATAACCGTAACCCAGAGAGCGCTGGCTAGTCAAATCCCTGCAAACCCTAACCGAGAC
JMFS154F08+ CACATAACCGTAACCCAGAGAGCGCTGGCTAGTCAAATCCCTGCAAACCCTAACCGAGAC
JMFS156G02+ CACATAACCGTAACCCAGAGAGCGCTGGCTAGTCAAATCCCTGCAAACCCTAACCGAGAC
JMFS097B07+ CACATAACCGTAACCCAGAGAGCGCTGGCTAGTCAAATCCCTGCAAACCCTAACCGAGAC
JMFF047N02+ CACATAACCGTAACCCAGAGAGCGCTGGCTAGTCAAATCCCTGCAAACCCTAACCGAGAC
JMFS055H09+ CACATAACCGTAACCCAGAGAGCGCTGGCTAGTCAAATCCCTGCAAACCCTAACCGAGAC
                      ____________________________________________________________
consensus CACATAACCGTAACCCAGAGAGCGCTGGCTAGTCAAATCCCTGCAAACCCTAACCGAGAC
 
. : . : . : . : . : . :
JMFS037H07+ CACTTGCCCGAGCTGGTTGAAAATATCGTACAGCTGGGAATCCGTGACGGTAGAATCGAG
JMFS129A03+ CACTTGCCCGAGCTGGTTGAAAATATCGTACAGCTGGGAATCCGTGACGGTAGAATCGAG
JMFS033G01+ CACTTGCCCGAGCTGGTTGAAAATATCGTACAGCTGGGAATCCGTGACGGTAGAATCGAG
JMFS108B12+ CACTTGCCCGAGCTGGTTGAAAATATCGTACAGCTGGGAATCCGTGACGGTAGAATCGAG
JMFS012G03+ CACTTGCCCGAGCTGGTTGAAAATATCGTACAGCTGGGAATCCGTGACGGTAGAATCGAG
JMFS126A10+ CACTTGCCCGAGCTGGTTGAAAATATCGTACAGCTGGGAATCCGTGACGGTAGAATCGAG
JMFS168H02+ CACTTGCCCGAGCTGGTTGAAAATATCGTACAGCTGGGAATCCGTGACGGTAGAATCGAG
JMFS045H07+ CACTTGCCCGAGCTGGTTG-AAATATCGTACAGCTGGGAATCCGTGACGGTAGAATCGAG
JMFS070C05+ CACTTGCCCGAGCTGGTTGAAAATATCGTACAGCTGGGAATCCGTGACGGTAGAATCGAG
JMFS115D11+ CACTTGCCCGAGCTGGTTGAAAATATCGTACAGCTGGGAATCCGTGACGGTAGAATCGAG
JMFS154F08+ CACTTGCCCGAGCTGGTTGAAAATATCGTACAGCTGGGAATCCGTGACGGTAGAATCGAG
JMFS156G02+ CACTTGCCCGAGCTGGTTGAAAATATCGTACAGCTGGGAATCCGTGACGGTAGAATCGAG
JMFS097B07+ CACTTGCCCGAGCTGGTTGAAAATATCGTACAGCTGGGAATCCGTGACGGTAGAATCGAG
JMFF047N02+ CACTTGCCCGAGCTGGTTGAAAATATCGTACAGCTGGGAATCCGTGACGGTAGAATCGAG
JMFS055H09+ CACTTGCCCGAGCTGGTTGAAAATATCGTACAGCTGGGAATCCGTGACGGTAGAATCGAG
                      ____________________________________________________________
consensus CACTTGCCCGAGCTGGTTGAAAATATCGTACAGCTGGGAATCCGTGACGGTAGAATCGAG
 
. : . : . : . : . : . :
JMFS037H07+ ATCGCCCACGTAAAGCGACGTCACGAACTGGTTCACTCCCCCACTGGGGTTCCCGGCCTG
JMFS129A03+ ATCGCCCACGTAAAGCGACGTCACGAACTGGTTCACTCCCCCACTGGGGTTCCCGGCCTG
JMFS033G01+ ATCGCCCACGTAAAGCGACGTCACGAACTGGTTCACTCCCCCACTGGGGTTCCCGGCCTG
JMFS108B12+ ATCGCCCACGTAAAGCGACGTCACGAACTGGTTCACTCCCCCACTGGGGTTCCCGGCCTG
JMFS012G03+ ATCGCCCACGTAAAGCGACGTCACGAACTGGTTCACTCCCCCACTGGGGTTCCCGGCCTG
JMFS126A10+ ATCGCCCACGTAAAGCGACGTCACGAACTGGTTCACTCCCCCACTGGGGTTCCCGGCCTG
JMFS168H02+ ATCGCCCACGTAAAGCGACGTCACGAACTGGTTCACTCCCCCACTGGGGTTCCCGGCCTG
JMFS045H07+ ATCGCCCACGTAAAGCGACGTCACGAACTGGTTCACTCCCCCACTGGGGTTCCCGGCCTG
JMFS070C05+ ATCGCCCACGTAAAGCGACGTCACGAACTGGTTCACTCCCCCACTGGGGTTCCCGGCCTG
JMFS115D11+ ATCGCCCACGTAAAGCGACGTCACGAACTGGTTCACTCCCCCACTGGGGTTCCCGGCCTG
JMFS154F08+ ATCGCCCACGTAAAGCGACGTCACGAACTGGTTCACTCCCCCACTGGGGTTCCCGGCCTG
JMFS156G02+ ATCGCCCACGTAAAGCGACGTCACGAACTGGTTCACTCCCCCACTGGGGTTCCCGGCCTG
JMFS097B07+ ATCGCCCACGTAAAGCGACGTCACGAACTGGTTCACTCCCCCACTGGGGTTCCCGGCCTG
JMFF047N02+ ATCGCCCACGTAAAGCGACGTCACGAACTGGTTCACTCCCCCACTGGGGTTCCCGGCCTG
JMFS055H09+ ATCGCCCACGTAAAGCGACGTCACGAACTGGTTCACTCCCCCACTGGGGTTCCCGGCCTG
                      ____________________________________________________________
consensus ATCGCCCACGTAAAGCGACGTCACGAACTGGTTCACTCCCCCACTGGGGTTCCCGGCCTG
 
. : . : . : . : . : . :
JMFS037H07+ AGGCTGCACCTGAACCTGTGCCATCCTAGTTCAAAACCCTAGCAGAAAAAATTGGAATTT
JMFS129A03+ AGGCTGCACCTGAACCTGTGCCATCCTAGTTCAAAACCCTAGCAGAAAAAATTGGAATTT
JMFS033G01+ AGGCTGCACCTGAACCTGTGCCATCCTAGTTCAAAACCCTAGCAGAAAAAATTGGAATTT
JMFS108B12+ AGGCTGCACCTGAACCTGTGCCATCCTAGTTCAAAACCCTAGCAGAAAAAATTGGAATTT
JMFS012G03+ AGGCTGCACCTGAACCTGTGCCATCCTAGTTCAAAACCCTAGCAGAAAAAATTGGAATTT
JMFS126A10+ AGGCTGCACCTGAACCTGTGCCATCCTAGTTCAAAACCCTAGCAGAAAAAATTGGAATTT
JMFS168H02+ AGGCTGCACCTGAACCTGTGCCATCCTAGTTCAAAACCCTAGCAGAAAAAATTGGAATTT
JMFS045H07+ AGGCTGCACCTGAACCTGTGCCATCCTAGTTCAAAACCCTAGCAGAAAAAATTGAAATTT
JMFS070C05+ AGGCTGCACCTGAACCTGTGCCATCCTAGTTCAAAACCCTAGCAGAAAAAATTGGAATTT
JMFS115D11+ AGGCTGCACCTGAACCTGTGCCATCCTAGTTCAAAACCCTAGCAGAAAAAATTGGAATTT
JMFS154F08+ AGGCTGCACCTGAACCTGTGCCATCCTAGTTCAAAACCCTAGCAGAAAAAATTGGAATTT
JMFS156G02+ AGGCTGCACCTGAACCTGTGCCATCCTAGTTCAAAACCCTAGCAGAAAAAATTGGAATTT
JMFS097B07+ AGGCTGCACCTGAACCTGTGCCATCCTAGTTCAAAACCCTAGCAGAAAAAATTGGAATTT
JMFF047N02+ AGGCTGCACCTGAACCTGTGCCATCCTAGTTCAAAACCCTAGCAGAAAAAATTGGAATTT
JMFS055H09+ AGGCTGCACCTGAACCTGTGCCATCCTAGTTCAAAACCCTAGCAGAAAAAATTGGAATTT
                      ____________________________________________________________
consensus AGGCTGCACCTGAACCTGTGCCATCCTAGTTCAAAACCCTAGCAGAAAAAATTGGAATTT
 
. : . : . : . : . : . :
JMFS037H07+ TTTTCCCGATATTTTTATATATATTTTTTTGTGCTTTTTTCACTTCCCTCTCCTCTTTTT
JMFS129A03+ TTTTCCCGATATTTTTATATATATTTTTTTGTGCTTTTTTCACTTCCCTCTCCTCTTTTT
JMFS033G01+ TTTTCCCGATATTTTTATATATATTTTTTTGTGCTTTTTTCACTTCCCTCTCCTCTTTTT
JMFS108B12+ TTTTCCCGATATTTTTATATATATTTTTTTGTGCTTTTTTCACTTCCCTCTCCTCTTTTT
JMFS012G03+ TTTTCCCGATATTTTTATATATATTTTTTTGTGCTTTTTTCACTTCCCTCTCCTCTTTTT
JMFS126A10+ TTTTCCCGATATTTTTATATATATTTTTTTGTGCTTTTTTCACTTCCCTCTCCTCTTTTT
JMFS168H02+ TTTTCCCGATATTTTTATATATATTTTTTTGTGCTTTTTTCACTTCCGTCTCCTCTTTTT
JMFS045H07+ TTTTCCCGATATTTTTATATATATTTTTTTGTGCTTTTTTCACTTCCCTCTCCTCTTTTT
JMFS070C05+ TTTTCCCGATATTTTTATATATATTTTTTTGTGCTTTTTTCACTTCCCTCTCCTCTTTTT
JMFS115D11+ TTTTCCCGATATTTTTATATATATTTTTTTGTGCTTTTTTCACTTCCCTCTCCTCTTTTT
JMFS154F08+ TTTTCCCGATATTTTTATATATATTTTTTTGTGCTTTTTTCACTTCCCTCTCCTCTTTTT
JMFS156G02+ TTTTCCCGATATTTTTATATATATTTTTTTGTGCTTTTTTCACTTCCCTCTCCTCTTTTT
JMFS097B07+ TTTTCCCGATATTTTTATATATATTTTTTTGTGCTTTTTTCACTTCCCTCTCCTCTTTTT
JMFF047N02+ TTTTCCCGATATTTTTATATATATTTTTTTGTGCTTTTTTCACTTCCCTCTCCTCTTTTT
JMFS055H09+ TTTTCCCGATATTTTTATATATATTTTTTTGTGCTTTTTTCACTTCCCTCTCCTCTTTTT
                      ____________________________________________________________
consensus TTTTCCCGATATTTTTATATATATTTTTTTGTGCTTTTTTCACTTCCCTCTCCTCTTTTT
 
. : . : . : . : . : . :
JMFS037H07+ ATTGGCAGAAAAATACAAGTTCAATCGAT
JMFS129A03+ ATTGGCAGAAAAATACAAGTTCAATCGATTTGGATAAGAAACAAAAGAAAAAG---AAAA
JMFS033G01+ ATTGGCAGAAAAATACAAGTTCAATCGATTTGGATAAGAAACAAAAGAAAAAG---AAAA
JMFS108B12+ ATTGGCAGAAAAATACAAGTTCAATCGATTTGGATAAGAAACAAAAGAAAAAG---AAAA
JMFS012G03+ ATTGGCAGAAAAATACAAGTTCAATCGATTTGGATAAGAAACAAAAGAAAAAG---AAAA
JMFS126A10+ ATTGGCAGAAAAATACAAGTTCAATCGATTTGGATAAGAAACAAAAGAAAAAG---AAAA
JMFS168H02+ ATTGGCAGAAAAATACAAGTTCAATCGATTTGGATAAGAAACAAAAGAAAAAG---AAAA
JMFS045H07+ ATTGGCAGAAAAATACAAGTTCAATCGATTTGGATAAGAAACAAAAGAAAAAG---AAAA
JMFS070C05+ ATTGGCAGAAAAATACAAGTTCAATCGATTTGGATAAGAAACAAAAGAAAAAG---AAAA
JMFS115D11+ ATTGGCAGAAAAATACAAGTTCAATCGATTTGGATAAGAAACAAAAGAAAAAG---AAAA
JMFS154F08+ ATTGGCAGAAAAATACAAGTTCAATCGATTTGGATAAGAAACAAAAGAAAAAG---AAAA
JMFS156G02+ ATTGGCAGAAAAATACAAGTTCAATCGATTTGGATAAGAAACAAAAGAAAAAG---AAAA
JMFS097B07+ ATTGGCAGAAAAATACAAGTTCAATCGATTTGGATAAGAAACAAAAGAAAAAG---AAAA
JMFF047N02+ ATTGGCAGAAAAATACAAGTTCAATCGATTTGGATAAGAAACAAAAGAAAAAGAAAAAAA
JMFS055H09+ ATTGGCAGAAAAATACAAGTTCAATCGATTTGGATAAGAAACAAAAGAAAAAG---AAAA
                      ____________________________________________________________
consensus ATTGGCAGAAAAATACAAGTTCAATCGATTTGGATAAGAAACAAAAGAAAAAG---AAAA
 
. : . : . : . : . : . :
JMFS129A03+ AAAGAAAATCAAACCCCCCGAGGAATTTTTGAAAAATTTTTGCGAGATTTTC-TTTTTTC
JMFS033G01+ AAAGAAAATCAAACCCCCCGAGGAATTTTTGAAAAATTTTTGCGAGATTTTC-TTTTTTC
JMFS108B12+ AAAGAAAATCAAACCCCCCGAGGAATTTTTGAAAAATTTTTGCGAGATTTTC-TTTTTTC
JMFS012G03+ AAAGAAAATCAAACCCCCCGAGGAATTTTTGAAAAATTTTTGCGAGATTTTC-TTTTTTC
JMFS126A10+ AAAGAAAATCAAACCCCCCGAGGAATTTTTGAAAAATTTTTGCGAGATTTTC-TTTTTTC
JMFS168H02+ AAAGAAAATCAAACCCCCCGAGGAATTTTTGAAAAATTTTTGCGAGATTTTC-TTTTTTC
JMFS045H07+ AAAGAAAATCAAACCCCCCGAGGAATTTTTGAAAAATTTTTGCGAGATTTTC-TTTTTTC
JMFS070C05+ AAAGAAAATCAAACCCCCCGAGGAATTTTTGAAAAATTTTTGCGAGATTTTC-TTTTTTC
JMFS115D11+ AAAGAAAATCAAACCCCCCGAGGAATTTTTGAAAAATTTTTGCGAGATTTTC-TTTTTTC
JMFS154F08+ AAAGAAAATCAAACCCCCCGAGGAATTTTTGAAAAATTTTTGCGAGATTTTC-TTTTTTC
JMFS156G02+ AAAGAAAATCAAACCCCCCGAGGAATTTTTGAAAAATTTTTGCGAGATTTTCTTTTTTTC
JMFS097B07+ AAAGAAAATCAAACCCCCCGAGGAATTTTTGAAAAATTTTTGCGAGATTTTC-TTTTTTC
JMFF047N02+ AAAGAAAATCAAACCCCCCGAGGAATTTTTGAAAAATTTTTGCGAGATTTTC-TTTTTTC
JMFS055H09+ AAAGAAAATCAAACCCCCCGAGGAATTTTTGAAAAATTTTTGCGAGATTTTC-TTTTTTC
                      ____________________________________________________________
consensus AAAGAAAATCAAACCCCCCGAGGAATTTTTGAAAAATTTTTGCGAGATTTTC-TTTTTTC
 
. : . : . : . : . : . :
JMFS129A03+ TTTTTTGGTTTTTTTTGATATGATTTTTAAAACATT---AAAAAAAAAAAAAATAAAGAG
JMFS033G01+ TTTTTTGGTTTTTTTTGATATGATTTTTAAAACATTAAAAAAAAAAAAAAAAATAAAGAG
JMFS108B12+ TTTTTTGGTTTTTTTTGATATGATTTTTAAAACATT-AAAAAAAAAAAAAAAATAAAGAG
JMFS012G03+ TTTTTTGGTTTTTTTTGATATGATTTTTAAAACATT----AAAAAAAAAAAAATAAAGAG
JMFS126A10+ TTTTTTGGTTTTTTTTGATATGATTTTTAAAACATT---AAAAAAAAAAAAAATAAAGAG
JMFS168H02+ TTTTTTGGTTTTTTTTGATATGATTTTTAAAACATT---AAAAAAAAAAAAAATAAAGAG
JMFS045H07+ TTTTTTGGTTTTTTTTGATATGATTTTTAAAACATT----AAAAAAAAAAAAATAAAGAG
JMFS070C05+ TTTTTTGGTTTTTTTTGATATGATTTTTAAAACATT----AAAAAAAAAAAAATAAAGAG
JMFS115D11+ TTTTTTGGTTTTTTTTGATATGATTTTTAAAACATT---AAAAAAAAAAAAAATAAAGAG
JMFS154F08+ TTTTTTGGTTTTTTTTGATATGATTTTTAAAACATT--AAAAAAAAAAAAAAATAAAGAG
JMFS156G02+ TTTTTTGGTTTTTTTTGATATGATTTTTAAAACATT-AAAAAAAAAAAAAAAATAAAGAG
JMFS097B07+ TTTTTTGGTTTTTTTTGATATGATTTTTAAAACATT--AAAAAAAAAAAAAAATAAAGAG
JMFF047N02+ TTTTTTGGTTTTTTTTGATATGATTTTTAAAACATT---AAAAAAAAAAAAAATAAAGAG
JMSF005C18+ AAAAAAAAAAAAAAATAAAGAG
JMFS055H09+ TTTTTTGGTTTTTTTTGATATGATTTTTAAAACATT-AAAAAAAAAAAAAAAATAAAGAG
                      ____________________________________________________________
consensus TTTTTTGGTTTTTTTTGATATGATTTTTAAAACATT---AAAAAAAAAAAAAATAAAGAG
 
. : . : . : . : . : . :
JMFS129A03+ AGGAGAGGGAAGTGTGGATAGGGAAGGATAGTCGGGAATCCGACAAGCGGACGAAGAGAT
JMFS033G01+ AGGAGAGGGAAGTGTGGATAGGGAAGGATAGTCGGGAATCCGACAAGCGGACGAA
JMFS108B12+ AGGAGAGGGAAGTGTGGATAGGGAAGGATAGTCGGGAATCCGACAAGCGGACGAAGA
JMFS012G03+ AGGAGAGGGAAGTGTGGATAGGGAAGGATAGTCGGGAATCCGACAAGCGGACGAAG
JMFS126A10+ AGGAGAGGGAAGTGTGGATAGGGAAGGATAGTCGGGAATCCGACAAGCGGACGAAGAGAT
JMFS168H02+ AGGAGAGGGAAGTGTGGATAGGGAAGGATAGTCGGGAATCCGACAAGCGGACGAAGAGAT
JMFS045H07+ AGGAGAGGGAAGTGTGGATAGGGAAGGATAGTCGGGAATCCGACAAGCGGACGAAGAGAT
JMFS070C05+ AGGAGAGGGAAGTGTGGATAGGGAAGGATAGTCGGGAATCCGACAAGCGGACGAAGAGAT
JMFS115D11+ AGGAGAGGGAAGTGTGGATAGGGAAGGATAGTCGGGAATCCGACAAGCGGACGAAGAGAT
JMFS154F08+ AGGAGAGGGAAGTGTGGATAGGGAAGGATAGTCGGGAATCCGACAAGCGGACGAAGAGAT
JMFS156G02+ AGGAGAGGGAAGTGTGGATAGGGAAGGATAGTCGGGAATCCGACAAGCGGACGAAGAGAT
JMFS097B07+ AGGAGAGGGAAGTGTGGATAGGGAAGGATAGTCGGGAATCCGACAAGCGGACGAAGAGAT
JMFF047N02+ AGGAGAGGGAAGTGTGGATAGGGAAGGATAGTCGGGAATCCGACAAGCGGACGAAGAGAT
JMSF005C18+ AGGAGAGGGAAGTGTGGATAGGGAAGGATAGTCGGGAATCCGACAAGCGGACGAAGAGAT
JMFS055H09+ AGGAGAGGGAAGTGTGGATAGGGAAGGATAGTCGGGAATCCGACAAGCGGACGAAGAGAT
                      ____________________________________________________________
consensus AGGAGAGGGAAGTGTGGATAGGGAAGGATAGTCGGGAATCCGACAAGCGGACGAAGAGAT
 
. : . : . : . : . : . :
JMFS129A03+ CGCC
JMFS126A10+ CGCCG
JMFS168H02+ CGCCGCCGGTGACTGAAA
JMFS045H07+ CGCCGCCGGTGA
JMFS070C05+ CGCCGCCGGTGACTG
JMFS115D11+ CGCCGCCGGTGACTGAAA
JMFS154F08+ CGCCGCCGGTGACTGAAATAGCAGA
JMFS156G02+ CGCCGCCGGTGACTGAAATA
JMFS097B07+ CGCCGCCGGTGACTGAAATAGCAGA
JMFF047N02+ CGCCGCCGGTGACTGAAATAGCAGACAGAGAGGAAGAGA
JMSF005C18+ CGCCGCCGGTGACTGAAATAGCAGACAGAGAGGAAGAGATGGAGAGGGCC
JMFS055H09+ CGCCGCCGGTGACTGAAATAGCAGACAGAGAGGAAGAGATGGAGAGGGCAAACTCCAAAA
                      ____________________________________________________________
consensus CGCCGCCGGTGACTGAAATAGCAGACAGAGAGGAAGAGATGGAGAGGGCCAACTCCAAAA