Previous Contig 003330:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF038C14Sequence493003330 (2)sp|P53535|PHS2_SOLTU5e-77Alpha-1,4 glucan phosphorylase, L-2 isozyme, chloroplast precursor (EC 2.4.1.1) 658021538sp|P53535|PHS2_SOLTU3e-60Alpha-1,4 glucan phosphorylase, L-2 isozyme, chloroplast precursor (EC 2.4.1.1)
JMFS055G08Sequence613003330 (2)sp|P53535|PHS2_SOLTU3e-60Alpha-1,4 glucan phosphorylase, L-2 isozyme, chloroplast precursor (EC 2.4.1.1)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF038C14+ GTAAATCAAAAGCTTCTGCAGCAACTTTNGTTGACCATAAACGAAGGTTAAGA
                      ____________________________________________________________
consensus GTAAATCAAAAGCTTCTGCAGCAACTTTNGTTGACCATAAACGAAGGTTAAGA
 
. : . : . : . : . : . :
JMFF038C14+ GTGGTTTTGGTTTTGTATCCCGGGATCGGGACATCATAGGCAACCGCTATTACATCTTCT
                      ____________________________________________________________
consensus GTGGTTTTGGTTTTGTATCCCGGGATCGGGACATCATAGGCAACCGCTATTACATCTTCT
 
. : . : . : . : . : . :
JMFF038C14+ CCTCCAACCCATTCCTTCCTTCCATCAGCACCTTCAATCACTTCCCCGTAGAATTTCACA
                      ____________________________________________________________
consensus CCTCCAACCCATTCCTTCCTTCCATCAGCACCTTCAATCACTTCCCCGTAGAATTTCACA
 
. : . : . : . : . : . :
JMFF038C14+ GGATATGAGATATCGTTTCTAGCAATCTCCCAAGGGTTGCCCATCTCAAGCCAATTTTCA
                      ____________________________________________________________
consensus GGATATGAGATATCGTTTCTAGCAATCTCCCAAGGGTTGCCCATCTCAAGCCAATTTTCA
 
. : . : . : . : . : . :
JMFF038C14+ GCAACTTCCTCCTGACCATCTTTCGTTATAAGCTGTTTGAAAAGGCCGTATTTGTATCTA
                      ____________________________________________________________
consensus GCAACTTCCTCCTGACCATCTTTCGTTATAAGCTGTTTGAAAAGGCCGTATTTGTATCTA
 
. : . : . : . : . : . :
JMFF038C14+ AGTCCATAACCCCATGCAGGGTAATTAAGTGTAGCCATTGAATCTAAGAAGCATGAGGCA
JMFS055G08+ GAAGCATGAGGCA
                      ____________________________________________________________
consensus AGTCCATAACCCCATGCAGGGTAATTAAGTGTAGCCATTGAATCTAAGAAGCATGAGGCA
 
. : . : . : . : . : . :
JMFF038C14+ AGCCGTCCTAATCCTCCATTCCCTAAAGCGGCATCTGGTTCCTGCTTAGCTACATCCTCT
JMFS055G08+ AGCCGTCCTAATCCTCCATTCCCTAAAGCGGCATCTGGTTCCTGCTTAGCTACATCCTCT
                      ____________________________________________________________
consensus AGCCGTCCTAATCCTCCATTCCCTAAAGCGGCATCTGGTTCCTGCTTAGCTACATCCTCT
 
. : . : . : . : . : . :
JMFF038C14+ AGGTTGTGCCCGAGCTTTTTTAAAGCCTCTGCATAAGCTCCTGTTAGCTCCAAGTTACCA
JMFS055G08+ AGGTTGTGCCCGAGCTTTTTTAAAGCCTCTGCATAAGCTCCTGTTAGCTCCAAGTTACCA
                      ____________________________________________________________
consensus AGGTTGTGCCCGAGCTTTTTTAAAGCCTCTGCATAAGCTCCTGTTAGCTCCAAGTTACCA
 
. : . : . : . : . : . :
JMFF038C14+ ATTGCATTGAGCAGTGCTCT
JMFS055G08+ ATTGCATTGAGCAGTGCTCTACCCTGGAGAAATTCAATAGAAAGATAATAAGCCTGTTTT
                      ____________________________________________________________
consensus ATTGCATTGAGCAGTGCTCTACCCTGGAGAAATTCAATAGAAAGATAATAAGCCTGTTTT
 
. : . : . : . : . : . :
JMFS055G08+ ACATTCATCTTCTCATAATAATCATATGTAGCATTCCAATTTATAATGAGCATATCACGA
                      ____________________________________________________________
consensus ACATTCATCTTCTCATAATAATCATATGTAGCATTCCAATTTATAATGAGCATATCACGA
 
. : . : . : . : . : . :
JMFS055G08+ ACACTCCCTGCTGTTGCATTGAATGCCTTTGGAAGCTCAAACCGCTCGGGAGAAAATGAT
                      ____________________________________________________________
consensus ACACTCCCTGCTGTTGCATTGAATGCCTTTGGAAGCTCAAACCGCTCGGGAGAAAATGAT
 
. : . : . : . : . : . :
JMFS055G08+ GGCGTGAACTCTGCATGGTATTTTATACTTGATGCAAGAGATGCTGAATCTGGTTGAAAA
                      ____________________________________________________________
consensus GGCGTGAACTCTGCATGGTATTTTATACTTGATGCAAGAGATGCTGAATCTGGTTGAAAA
 
. : . : . : . : . : . :
JMFS055G08+ GCATCCAATGCCAGCCCTTCGTTATCAGATGAATAATCTTTAACTCTTTGTTGATGATCA
                      ____________________________________________________________
consensus GCATCCAATGCCAGCCCTTCGTTATCAGATGAATAATCTTTAACTCTTTGTTGATGATCA
 
. : . : . : . : . : . :
JMFS055G08+ CTAGCAACATTGCTGATAAGTAGATTTCTTCTTCGCCAATGAATCAAATGGAACCCACCC
                      ____________________________________________________________
consensus CTAGCAACATTGCTGATAAGTAGATTTCTTCTTCGCCAATGAATCAAATGGAACCCACCC
 
. : . : . : . : . : . :
JMFS055G08+ CTCCTTTTATTGGAGAAAAAGTTTGGGTTTTCACCCCTGAAGCCATTGAAACCAAGAATG
                      ____________________________________________________________
consensus CTCCTTTTATTGGAGAAAAAGTTTGGGTTTTCACCCCTGAAGCCATTGAAACCAAGAATG
 
. : . : . : . : . : . :
JMFS055G08+ GTGCTTGTAATGGAGCTTGAATGTGAAATTGAGTTCACCCCAACCCAAGAAAATGCTGGA
                      ____________________________________________________________
consensus GTGCTTGTAATGGAGCTTGAATGTGAAATTGAGTTCACCCCAACCCAAGAAAATGCTGGA