Previous Contig 003324:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS051H09Sequence528003324 (3)gb:AB029509_15182014e-63Oryza sativa mRNA for small GTP-binding protein OsRac2, complete cds.>gb:AC13060
JMFS055D10Sequence613003324 (3)pir|T08950|T089503e-75GTP binding protein Arac7 [imported] - Arabidopsis thaliana>gb:AX717076_1473748
JMFS064G10Sequence625003324 (3)pir|T08950|T089504e-86GTP binding protein Arac7 [imported] - Arabidopsis thaliana>gb:AX717076_1473748

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS064G10+ GTCGAATACTGCT
                      ____________________________________________________________
consensus GTCGAATACTGCT
 
. : . : . : . : . : . :
JMFS064G10+ TTCACATTCTGCTGAGTNTTAGAGCTACACTCTATGTATGCTGCTGCGCCAATNTGCTTC
JMFS055D10+ GCTTC
                      ____________________________________________________________
consensus TTCACATTCTGCTGAGTNTTAGAGCTACACTCTATGTATGCTGCTGCGCCAATNTGCTTC
 
. : . : . : . : . : . :
JMFS064G10+ CTTAATTCCTCGCCTTGGGCTGGTGTAATAACGTTAGAACCCATATGATCAGCCAGATAT
JMFS055D10+ CTTAATTCCTCGCCTTGGGCTGGTGTAATAACGTTAGAACCCATATGATCAGCCAGATAT
                      ____________________________________________________________
consensus CTTAATTCCTCGCCTTGGGCTGGTGTAATAACGTTAGAACCCATATGATCAGCCAGATAT
 
. : . : . : . : . : . :
JMFS064G10+ CGATTGTCATCACGAAGATCTAGTTTCGTTCCGACCAGAACGATTGGAACGTTGGGCGCA
JMFS051H09+ ATCACGAAGATCTAGTTTCGTTCCGACCAGAACGATTGGAACGTTGGGCGCA
JMFS055D10+ CGATTGTCATCACGAAGATCTAGTTTCGTTCCGACCAGAACGATTGGAACGTTGGGCGCA
                      ____________________________________________________________
consensus CGATTGTCATCACGAAGATCTAGTTTCGTTCCGACCAGAACGATTGGAACGTTGGGCGCA
 
. : . : . : . : . : . :
JMFS064G10+ AACCGGCGAAGTTCAGGCATCCACTTTTTGAGAACATTTTCATAGCTTGCCCTGCTAATT
JMFS051H09+ AACCGGCGAAGTTCAGGCATCCACTTTTTGAGAACATTTTCATAGCTTGCCCTGCTAATT
JMFS055D10+ AACCGGCGAAGTTCAGGCATCCACTTTTTGAGAACATTTTCATAGCTTGCCCTGCTAATT
                      ____________________________________________________________
consensus AACCGGCGAAGTTCAGGCATCCACTTTTTGAGAACATTTTCATAGCTTGCCCTGCTAATT
 
. : . : . : . : . : . :
JMFS064G10+ AAAGAGAAAGCCAAAACAAATATGTCTGCTCCTCTGTAACTCAGTGGCCTCAACCTGCTG
JMFS051H09+ AAAGAGAAAGCCAAAACAAATATGTCTGCTCCTCTGTAACTCAGTGGCCTCAACCTGCTG
JMFS055D10+ AAAGAGAAAGCCAAAACAAATATGTCTGCTCCTCTGTAACTCAGTGGCCTCAACCTGCTG
                      ____________________________________________________________
consensus AAAGAGAAAGCCAAAACAAATATGTCTGCTCCTCTGTAACTCAGTGGCCTCAACCTGCTG
 
. : . : . : . : . : . :
JMFS064G10+ TAATCTTCCTGGCCAGCAGTATCCCATAATCCCAGGTTAACAATGTTACCATCCACAGCC
JMFS051H09+ TAATCTTCCTGGCCAGCAGTATCCCATAATCCCAGGTTAACAATGTTACCATCCACAGCC
JMFS055D10+ TAATCTTCCTGGCCAGCAGTATCCCATAATCCCAGGTTAACAATGTTACCATCCACAGCC
                      ____________________________________________________________
consensus TAATCTTCCTGGCCAGCAGTATCCCATAATCCCAGGTTAACAATGTTACCATCCACAGCC
 
. : . : . : . : . : . :
JMFS064G10+ ACATTTGCACTGAAATTGTCAAACACTGTTGGAATATAATCAGTGGGGAACTTGTTACTG
JMFS051H09+ ACATTTGCACTGAAATTGTCAAACACTGTTGGAATATAATCAGTGGGGAACNTGTTACTG
JMFS055D10+ ACATTTGCACTGAAATTGTCAAACACTGTTGGAATATAATCAGTGGGGAACTTGTTACTG
                      ____________________________________________________________
consensus ACATTTGCACTGAAATTGTCAAACACTGTTGGAATATAATCAGTGGGGAACTTGTTACTG
 
. : . : . : . : . : . :
JMFS064G10+ GTATAACAAATGAGCATGCATGTCTTCCCCACAGCCCCATCACCAACAGTCACACATTTG
JMFS051H09+ GTATAACAAATGAGCATGCATGTCTTCCCCACAGCCCCATCACCAACAGTCACACATNTG
JMFS055D10+ GTATAACAAATGAGCATGCATGTCTTCCCCACAGCCCCATCACCAACAGTCACACATTTG
                      ____________________________________________________________
consensus GTATAACAAATGAGCATGCATGTCTTCCCCACAGCCCCATCACCAACAGTCACACATTTG
 
. : . : . : . : . : . :
JMFS064G10+ ATGAACTTTGAAGCACTCATCATCCCCCTCCTCTCAGATTCTACAGTAATGCCCTTCACA
JMFS051H09+ ATGAAC-TTGAAGCACTCATCATCCCCCTCCTNNCAGATTNNACAGTAAGGCCCTTCACA
JMFS055D10+ ATGAACTTTGAAGCACTCATCATCCCCCTCCTCTCAGATTCTACAGTAATGCCCTTCACA
                      ____________________________________________________________
consensus ATGAACTTTGAAGCACTCATCATCCCCCTCCTCTCAGATTCTACAGTAATGCCCTTCACA
 
. : . : . : . : . : . :
JMFS064G10+ CTCAAAGTCTTCCTTATAAGGTTAACCAAAGTTGAAAAAAAGAGAAAGTTGAAGAAGAAA
JMFS051H09+ CTCAAAGTCTTCCNNATAAGGTANACCAAAGTTGAAAAAAAGAGAAAGTTGAAGAAGAAA
JMFS055D10+ CTCAAAGTCTTCCTTATAAGGTTAACCAAAGTTGAAAAAAAGAGAAAGTTGAAGAAGAAA
                      ____________________________________________________________
consensus CTCAAAGTCTTCCTTATAAGGTTAACCAAAGTTGAAAAAAAGAGAAAGTTGAAGAAGAAA
 
. : . : . : . : . : . :
JMFS064G10+ GGCACAAAAGGG
JMFS051H09+ GGCACAAAAGGGAGAAAGGAAAAAAGAGAGNNTCACAGAAGCAAACAAGAG
JMFS055D10+ GGCACAAAAGGGAGAAAGGAAAAAAGAGAGTTTCACAGAAGCAAACAAGAGTGAGAGAGC
                      ____________________________________________________________
consensus GGCACAAAAGGGAGAAAGGAAAAAAGAGAGTTTCACAGAAGCAAACAAGAGTGAGAGAGC