Previous Contig 003321:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS006A09Sequence560003321 (10)gb:AF153276_17728251e-46Populus tremula x Populus tremuloides pumilio domain-containing protein PPD1 (PP
JMFS039E01Sequence475003321 (10)gb:AF153276_17728257e-09Populus tremula x Populus tremuloides pumilio domain-containing protein PPD1 (PP
JMFS039F01Sequence655003321 (10)gb:AF153276_17728252e-23Populus tremula x Populus tremuloides pumilio domain-containing protein PPD1 (PP
JMFS043D01Sequence602003321 (10)gb:AF153276_17728251e-17Populus tremula x Populus tremuloides pumilio domain-containing protein PPD1 (PP
JMFS047G12Sequence615003321 (10)gb:AF153276_17728252e-20Populus tremula x Populus tremuloides pumilio domain-containing protein PPD1 (PP
JMFS055C01Sequence609003321 (10)gb:AF153276_17728258e-22Populus tremula x Populus tremuloides pumilio domain-containing protein PPD1 (PP
JMFS127D06Sequence620003321 (10)gb:AF153276_17728252e-26Populus tremula x Populus tremuloides pumilio domain-containing protein PPD1 (PP
JMFS139F08Sequence613003321 (10)gb:AF153276_17728251e-36Populus tremula x Populus tremuloides pumilio domain-containing protein PPD1 (PP
JMFS140F10Sequence626003321 (10)gb:AF153276_17728251e-29Populus tremula x Populus tremuloides pumilio domain-containing protein PPD1 (PP
JMFS152G09Sequence625003321 (10)gb:AF153276_17728255e-30Populus tremula x Populus tremuloides pumilio domain-containing protein PPD1 (PP

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS043D01+ CCACCATGCAGGTTTTCTTGGAAACATCTGACCCAGTGCCACCGCCTCCAAG
JMFS047G12+ CCACCATGCAGG-GTTCTTGGAAACATCTGACCCAGTGCCACCGCCTCCAAG
                      ____________________________________________________________
consensus CCACCATGCAGGTTTTCTTGGAAACATCTGACCCAGTGCCACCGCCTCCAAG
 
. : . : . : . : . : . :
JMFS043D01+ TTCACTTCTCGAGCGTCGATCGCCGCCTGTTTCTTTGTTGTTTTCTCTAGAACATGGGTT
JMFS047G12+ TTCACTTCTCGAGCGTCGATCGCCGCCTGTTTCTTTGTTGTTTTCTCTAGAACATGGGTT
JMFS139F08+ TCTAGAACATGGGTT
                      ____________________________________________________________
consensus TTCACTTCTCGAGCGTCGATCGCCGCCTGTTTCTTTGTTGTTTTCTCTAGAACATGGGTT
 
. : . : . : . : . : . :
JMFS043D01+ CCCTAACGTTTCGAGATATGATGTCTCTCCAAAAGAGAGAATTGAAGAATTGTTAGCTCC
JMFS047G12+ CCCTAACGTTTCGAGATATGATGTCTCTCCAAAAGAGAGAATTGAAGAATTGTTAGCTCC
JMFS139F08+ CCCTAACGTTTCGAGATATGATGTCTCTCCAAAAGAGAGAATTGAAGAATTGTTAGCTCC
                      ____________________________________________________________
consensus CCCTAACGTTTCGAGATATGATGTCTCTCCAAAAGAGAGAATTGAAGAATTGTTAGCTCC
 
. : . : . : . : . : . :
JMFS043D01+ AGCTGCACTATGCCCGGTTAAAGCTTCGTTGCAAGAATCTGAACCCGTGTCAGGCAACTT
JMFS047G12+ AGCTGCACTATGCCCGGTTAAAGCTTCGTTGCAAGAATCTGAACCCGTGTCAGGCAACTT
JMFS139F08+ AGCTGCACTATGCCCGGTTAAAGCTTCGTTGCAAGAATCTGAACCCGTGTCAGGCAACTT
                      ____________________________________________________________
consensus AGCTGCACTATGCCCGGTTAAAGCTTCGTTGCAAGAATCTGAACCCGTGTCAGGCAACTT
 
. : . : . : . : . : . :
JMFS043D01+ CGGAATATCAAGAGAAAGATTTTCCAGGCCAAGTGCTTGAATATCACGTTTAGTTGGTTC
JMFS047G12+ CGGAATATCAAGAGAAAGATTTTCCAGGCCAAGTGCTTGAATATCACGTTTAGTTGGTTC
JMFS139F08+ CGGAATATCAAGAGAAAGATTTTCCAGGCCAAGTGCTTGAATATCACGTTTAGTTGGTTC
JMFS006A09+ CTTGAATATCACGTTAGTTTGGTTC
                      ____________________________________________________________
consensus CGGAATATCAAGAGAAAGATTTTCCAGGCCAAGTGCTTGAATATCACGTTTAGTTGGTTC
 
. : . : . : . : . : . :
JMFS043D01+ CTCCACAGCAATGTGGCCCGATAAACGAGACTGACTATAAAGTGGCGGAGTGCGTGCGAA
JMFS047G12+ CTCCACAGCAATGTGGCCCGATAAACGAGACTGACTATAAAGTGGCGGAGTGCGTGCGAA
JMFS139F08+ CTCCACAGCAATGTGGCCCGATAAACGAGACTGACTATAAAGTGGCGGAGTGCGTGCGAA
JMFS006A09+ CTCCACAGCAATGTGGCCCGATAAACGAGACTGACTATAAAGTGGCGGAGTGCGTGCGAA
                      ____________________________________________________________
consensus CTCCACAGCAATGTGGCCCGATAAACGAGACTGACTATAAAGTGGCGGAGTGCGTGCGAA
 
. : . : . : . : . : . :
JMFS043D01+ ATCATCCTGAATTAAATCAACCAAACTTTTACGCCGACCAATCAAAGTACCTATGTTCTG
JMFS047G12+ ATCATCCTGAATTAAATCAACCAAACTTTTACGCCGACCAATCAAAGTACCTATGTTCTG
JMFS139F08+ ATCATCCTGAATTAAATCAACCAAACTTTTACGCCGACCAATCAAAGTACCTATGTTCTG
JMFS006A09+ ATCATCCTGAATTAAATCAACCAAACTTTTACGCCGACCAATCAAAGTACCTATGTTCTG
                      ____________________________________________________________
consensus ATCATCCTGAATTAAATCAACCAAACTTTTACGCCGACCAATCAAAGTACCTATGTTCTG
 
. : . : . : . : . : . :
JMFS043D01+ TCCAGTCAATTCTGCGGCTCTACTCTCTGCCAAGTTATCTAAAGCATTCGGTGTTGAATT
JMFS047G12+ TCCAGTCAATTCTGCGGCTCTACTCTCTGCCAAGTTATCTAAAGCATTCGGTGTTGAATT
JMFS139F08+ TCCAGTCAATTCTGCGGCTCTACTCTCTGCCAAGTTATCTAAAGCATTCGGTGTTGAATT
JMFS006A09+ TCCAGTCAATTCTGCGGCTCTACTCTCTGCCAAGTTATCTAAAGCATTCGGTGTTGAATT
                      ____________________________________________________________
consensus TCCAGTCAATTCTGCGGCTCTACTCTCTGCCAAGTTATCTAAAGCATTCGGTGTTGAATT
 
. : . : . : . : . : . :
JMFS043D01+ TTCATCCTCGGGCTCTTCGATATGAGTTGAAAGAGAGCCTCTAGGAAAGTGCACCAGCCT
JMFS047G12+ TTCATCCTCGGGCTCTTCGATATGAGTTGAAAGAGAGCCTCTAGGAAAGTGCACCAGCCT
JMFS139F08+ TTCATCCTCGGGCTCTTCGATATGAGTTGAAAGAGAGCCTCTAGGAAAGTGCACCAGCCT
JMFS006A09+ TTCATCCTCGGGCTCTTCGATATGAGTTGAAAGAGAGCCTCTAGGAAAGTGCACCAGCCT
                      ____________________________________________________________
consensus TTCATCCTCGGGCTCTTCGATATGAGTTGAAAGAGAGCCTCTAGGAAAGTGCACCAGCCT
 
. : . : . : . : . : . :
JMFS043D01+ ATCGCCACTGTCACCAGAAGATGTGAATTTGTAGCTATCTTTCGTAGCCCCTACGTGGTG
JMFS047G12+ ATCGCCACTGTCACCAGAAGATGTGAATTTGTAGCTATCTTTCGTAGCCCCTACGTGGTG
JMFS139F08+ ATCGCCACTGTCACCAGAAGATGTGAATTTGTAGCTATCTTTCGTAGCCCCTACGTGGTG
JMFS006A09+ ATCGCCACTGTCACCAGAAGATGTGAATTTGTAGCTATCTTTCGTAGCCCCTACGTGGTG
                      ____________________________________________________________
consensus ATCGCCACTGTCACCAGAAGATGTGAATTTGTAGCTATCTTTCGTAGCCCCTACGTGGTG
 
. : . : . : . : . : . :
JMFS043D01+ TGCAAGATGC
JMFS047G12+ TGCAAGATGCCTATTCTCCCTTGA
JMFS139F08+ TGCAAGATGCCTATTCTCCCTTGAGATTATAGGTGGAGGAAGCCTAGGGTTCAAGTTGAC
JMFS006A09+ TGCAAGATGCCTATTCTCCCTTGAGATTATAGGTGGAGGAAGCCTAGGGTTCAAGTTGAC
JMFS039F01+ AGGGTTCAAGTTGAC
                      ____________________________________________________________
consensus TGCAAGATGCCTATTCTCCCTTGAGATTATAGGTGGAGGAAGCCTAGGGTTCAAGTTGAC
 
. : . : . : . : . : . :
JMFS139F08+ ATTCGAAGAATAGTATGCAAAATACGATGGATCGGACCGTATTTGTTCCTCAGACTGA
JMFS006A09+ ATTCGAAGAATAGTATGCAAAATACGATGGATCGGACCGTATTTGTTCCTCAGACTGACA
JMFS152G09+ AATAGTATGCAAAATACGATGGATCGGACCGTATTTGTTCCTCAGACTGACA
JMFS140F10+ CGAAGAATAGTATGCAAAATACGATGGATCGGACCGTATNTGTTCCTCAGACTGACA
JMFS039F01+ ATTCGAAGAATAGTATGCAAANTACGATGGATCGGACCGTA-TTGTTCCTCAGACTGACA
JMFS127D06+ GATGGATCGGACCGTATTTGTTCCTCAGACTGACA
JMFS055C01+ TCAGACTGACA
                      ____________________________________________________________
consensus ATTCGAAGAATAGTATGCAAAATACGATGGATCGGACCGTATTTGTTCCTCAGACTGACA
 
. : . : . : . : . : . :
JMFS006A09+ GTTCAGAAGAGCAGTGTCTAAATTCATCGAACCTAAATCCCAACCTCCTGATTGCTGATA
JMFS152G09+ GTTCAGAAGAGCAGTGTCTAAATTCATCGAACCTAAATCCCAACCTCCTGATTGCTGATA
JMFS140F10+ GTTCAGAAGAGCAGTGTCTAAATTCATCGAACCTAAATCCCAACCTCCTGATTGCTGATA
JMFS039F01+ GTTCAGAAGAGCAGTGTCTAAATTCATCGAACCTAGATCCCAACCTCCTGATTGCTGATA
JMFS127D06+ GTTCAGAAGAGCAGTGTCTAAATTCATCGAACCTAAATCCCAACCTCCTGATTGCTGATA
JMFS055C01+ GTTCAGAAGAGCAGTGTCTAAATTCATCGAACCTAAATCCCAACCTCCTGATTGCTGATA
                      ____________________________________________________________
consensus GTTCAGAAGAGCAGTGTCTAAATTCATCGAACCTAAATCCCAACCTCCTGATTGCTGATA
 
. : . : . : . : . : . :
JMFS006A09+ TATCAGGTTCCCGAATGCTGCAAATGAGCCTTCCATACTTGGAGGCGCACTGCCA
JMFS152G09+ TATCAGGTTCCCGAATGCTGCAAATGAGCCTTCCATACTTGGAGGCGCACTGCCACTACG
JMFS140F10+ TATCAGGTTCCCAAATGCTGCAAATGAGCCTTCCATACTTGGAGGCGCACTGCCACTACG
JMFS039E01+ TGGAGGCGCACTGCCAATACG
JMFS039F01+ TATCAGGTTCCCGAATGCTGCAAATGAGCCTTCCATACTTGGAGGCGCACTGCCACTACG
JMFS127D06+ TATCAGGTTCCCGAATGCTGCAAATGAGCCTTCCATACTTGGAGGCGCACTGCCACTACG
JMFS055C01+ TATCAGGTTCCCGAATGCTGCAAATGAGCCTTCCATACTTGGAGGCGCACTGCCACTACG
                      ____________________________________________________________
consensus TATCAGGTTCCCGAATGCTGCAAATGAGCCTTCCATACTTGGAGGCGCACTGCCACTACG
 
. : . : . : . : . : . :
JMFS152G09+ ATTAGGAGCCTTGTTTCTGTTATCACCCTGAACTTTATGCCCTTTTAGGAGCAACCCCAA
JMFS140F10+ ATTAGGAGCCTTGTTTCTGTTATCACCCTGAACTTTATGCCCTTTTAGGAGCAACCCCAA
JMFS039E01+ ATTAGGAGCCTTGTTTATGTTATCACCCTGAACGTAATGCCCTTTTAGGAGCAACCCCAA
JMFS039F01+ ATTAGGAGCCTTGTTTCTGTTATCACCCTGAACTTTATGCCCTTTTAGGAGCAACCCCAA
JMFS127D06+ ATTAGGAGCCTTGTTTCTGTTATCACCCTGAACTTTATGCCCTTTTAGGAGCAACCCCAA
JMFS055C01+ ATTAGGAGCCTTGTTTCTGTTATCACCCTGAACTTTATGCCCTTTTAGGAGCAACCCCAA
                      ____________________________________________________________
consensus ATTAGGAGCCTTGTTTCTGTTATCACCCTGAACTTTATGCCCTTTTAGGAGCAACCCCAA
 
. : . : . : . : . : . :
JMFS152G09+ CTCATCTACAGCCATTTCATTCATAGGCTGTGCATATGCCACATCATCCTTAGAAGAACC
JMFS140F10+ CTCATCTACAGCCATTTCATTCATAGGCTGTGCATATGCCACATCATCCTTAGAAGAACC
JMFS039E01+ CTCATGTACAGCCATTTCATTCATAGGCTGTGCATATGCCACATCATCCTTAGAAGAACC
JMFS039F01+ CTCATCTACAGCCATTTCATTCATAGGCTGTGCATATGCCACATCATCCTTAGAAGAACC
JMFS127D06+ CTCATCTACAGCCATTTCATTCATAGGCTGTGCATATGCCACATCATCCTTAGAAGAACC
JMFS055C01+ CTCATCTACAGCCATTTCATTCATAGGCTGTGCATATGCCACATCATCCTTAGAAGAACC
                      ____________________________________________________________
consensus CTCATCTACAGCCATTTCATTCATAGGCTGTGCATATGCCACATCATCCTTAGAAGAACC
 
. : . : . : . : . : . :
JMFS152G09+ CCACTGCTCACGTCTCCTACTTTCCACTATTCTC-ATGGGGTTTTCAGTTGCCATGCTGC
JMFS140F10+ CCACTGCTCACGTCTCCTACTTTCCACTATTCTC-ATGGGGTTTTCAGTTGCCATGCTGC
JMFS039E01+ CCACTGCTCACGTCTCGTACTTTCCACTATTCTCAATGGGGTTTTCAGTTGCCATGCTGC
JMFS039F01+ CCACTGCTCACGTCTCCTACTTTCCACTATTCTC-ATGGGGTTTTCAGTTGCCATGCTGC
JMFS127D06+ CCACTGCTCACGTCTCCTACTTTCCACTATTCTC-ATGGGGTTTTCAGTTGCCATGCTGC
JMFS055C01+ CCACTGCTCACGTCTCCTACTTTCCACTATTCTC-ATGGGGTTTTCAGTTGCCATGCTGC
                      ____________________________________________________________
consensus CCACTGCTCACGTCTCCTACTTTCCACTATTCTC-ATGGGGTTTTCAGTTGCCATGCTGC
 
. : . : . : . : . : . :
JMFS152G09+ TCAACGAATACAAAAAAACTTCCCTTCAGCAAATATCAAATTTCTAGCCAAGGCCCTTCA
JMFS140F10+ TCAACGAATACAAAAAAACTTCCCTTCAGCAAATATCAAATTTCTAGCCAAGGCCCTTCA
JMFS039E01+ TCAACGAATGCAAAAAAACTTCCCTTCAGCAAATATCAAATTTCTAGCCAAGGCCCTTCA
JMFS039F01+ TCAACGAATACAAAAAAACTTCCCTTCAGCAAATATCAAATTTCTAGCCAAGGCCCTTCA
JMFS127D06+ TCAACGAATACAAAAAAACTTCCCTTCAGCAAATATCAAATTTCTAGCCAAGGCCCTTCA
JMFS055C01+ TCAACGAATACAAAAAAACTTCCCTTCAGCAAATATCAAATTTCTAGCCAAGGCCCTTCA
                      ____________________________________________________________
consensus TCAACGAATACAAAAAAACTTCCCTTCAGCAAATATCAAATTTCTAGCCAAGGCCCTTCA
 
. : . : . : . : . : . :
JMFS152G09+ TCAACATCAG-GTCGCCAGTGAGTCTCAGAAGCTGACGTCCCCCGACCAAAGTCTGAAGC
JMFS140F10+ TCAACATCAG-GTCGCCAGTGAGTCTCAGAAGCTGACGTCCCCCGACCAAAGTCTGAAGC
JMFS039E01+ TCAACATCAGAGTCGCCAGTGAGTCTCAGAAGCTGACGTCCCCCGACCAAAGTCTGAAGC
JMFS039F01+ TCAACATCAG-GTCGCCAGTGAGTCTCAGAAGCTGACGTCCCCCGACCAAAGTCTGAAGC
JMFS127D06+ TCAACATCAG-GTCGCCAGTGAGTCTCAGAAGCTGACGTCCCCCGACCAAAGTCTGAAGC
JMFS055C01+ TCAACATCAG-GTCGCCAGTGAGTCTCAGAAGCTGACGTCCCCCGACCAAAGTCTGAAGC
                      ____________________________________________________________
consensus TCAACATCAG-GTCGCCAGTGAGTCTCAGAAGCTGACGTCCCCCGACCAAAGTCTGAAGC
 
. : . : . : . : . : . :
JMFS152G09+ TTGACGCCGCCTGCGACGATGGCCGATGATAATCAAGCCGTACGATCAATTCAATCCGTC
JMFS140F10+ TTGACGCCGCCTGCGACGATGGCCGATGATAATCAAGCCGTACGATCAATTCAATCCGTC
JMFS039E01+ TTGACGCCGCCTACGACGATGGCCGATGATAATCAAGCCGTACGATCAATTCAATCCGTC
JMFS039F01+ TTGACGCCGCCTGCGACGATGGCCGATGATAATCAAGCCGTACGATCAATTCAATCCGTC
JMFS127D06+ TTGACGCCGCCTGCGACGATGGCCGATGATAATCAAGCCGTACGATCAATTCAATCCGTC
JMFS055C01+ TTGACGCCGCCTGCGACGATGGCCGATGATAATCAAGCCGTACGATCAATTCAATCCGTC
                      ____________________________________________________________
consensus TTGACGCCGCCTGCGACGATGGCCGATGATAATCAAGCCGTACGATCAATTCAATCCGTC
 
. : . : . : . : . : . :
JMFS152G09+ AACAGATTTCCAGAGCCCAGCATAGAGAAGAATATGAAAGAGAAAGGGACAGAGCTTTCT
JMFS140F10+ AACAGATTTCCAGAGCCCAGCATAGAGAAGAATATGAAAGAGAAAGGGACAGAGCTTTCT
JMFS039E01+ AACAGATTTCCAGAGCCCAGCATAGAGAAGAATATGAAAGAGAAAGGGACAGAGCTTT-G
JMFS039F01+ AACAGATTTCCAGAGCCCAGCATAGAGAAGAATATGAAAGAGAAAGGGACAGAGCTTTCT
JMFS127D06+ AACAGATTTCCAGAGCCCAGCATAGAGAAGAATATGAAAGAGAAAGGGACAGAGCTTTCT
JMFS055C01+ AACAGATTTCCAGAGCCCAGCATAGAGAAGAATATGAAAGAGAAAGGGACAGAGCTTTCT
                      ____________________________________________________________
consensus AACAGATTTCCAGAGCCCAGCATAGAGAAGAATATGAAAGAGAAAGGGACAGAGCTTTCT
 
. : . : . : . : . : . :
JMFS152G09+ TGTTTCTTTAAGAGAAGTAGACGACTAGAGAGAGA
JMFS140F10+ TGTTTCTTTAAGAGAAGTAGACGACTAGAGA
JMFS039E01+ CGTTTC-TGAAGAGAAGTAGACGACTAGAGAAAGAG
JMFS039F01+ TGTTTCTTTAAGAGAAGTAGACGACTAGAGAGAGAG
JMFS127D06+ TGTTTCTTTAAGAGAAGTAGACGACTAGAGAGAGAGAGTATAG
JMFS055C01+ TGTTTCTTTAAGAGAAGTAGACGACTAGAGAGAGAGAGTATAGAGATACAGCATACAGAT
                      ____________________________________________________________
consensus TGTTTCTTTAAGAGAAGTAGACGACTAGAGAGAGAGAGTATAGAGATACAGCATACAGAT