Previous Contig 003315:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF042G14Sequence650002212 (6)602003315 (3)gb:AY074846_15676993e-48Arabidopsis thaliana At2g43020/MFL8.12 mRNA, complete cds.
JMFS054F05Sequence569003315 (3)gb:AY074846_15676992e-42Arabidopsis thaliana At2g43020/MFL8.12 mRNA, complete cds.
JMSF004K06Sequence391002212 (6)509003315 (3)gb:AY074846_15676991e-41Arabidopsis thaliana At2g43020/MFL8.12 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF042G14+ AAAAGAATA
                      ____________________________________________________________
consensus AAAAGAATA
 
. : . : . : . : . : . :
rJMFF042G14+ CTTCCCAATGCATCTCAGCCAGTTCAGTATCTTGTTTCTCATTGGGGAACGGATATAAAC
rJMSF004K06+ TCATTGGGGAACGGATATAAAC
JMFS054F05- TCATTGGGGAACGGATATAAAC
                      ____________________________________________________________
consensus CTTCCCAATGCATCTCAGCCAGTTCAGTATCTTGTTTCTCATTGGGGAACGGATATAAAC
 
. : . : . : . : . : . :
rJMFF042G14+ ACACTGGGTTCTTACAGCTACGATTTAGTAGGAAAATCCCATGACCTGTTTGAGAGGCTT
rJMSF004K06+ ACACTGGGTTCTTACAGCTACGATTTAGTAGGAAAATCCCATGACCTGTTTGAGAGGCTT
JMFS054F05- ACACTGGGTTCTTACAGCTACGATTTAGTAGGAAAATCCCATGACCTGTTTGAGAGGCTT
                      ____________________________________________________________
consensus ACACTGGGTTCTTACAGCTACGATTTAGTAGGAAAATCCCATGACCTGTTTGAGAGGCTT
 
. : . : . : . : . : . :
rJMFF042G14+ AGGATCCCCGTGGATAACCTGTTTTTCGCTGGAGAGGCTACAAGCTTAAATTACACAGGG
rJMSF004K06+ AGGATCCCCGTGGATAACCTGTTTTTCGCTGGAGAGGCTACAAGCTTAAATTACACAGGG
JMFS054F05- AGGATCCCCGTGGATAACCTGTTTTTCGCTGGAGAGGCTACAAGCTTAAATTACACAGGG
                      ____________________________________________________________
consensus AGGATCCCCGTGGATAACCTGTTTTTCGCTGGAGAGGCTACAAGCTTAAATTACACAGGG
 
. : . : . : . : . : . :
rJMFF042G14+ TCTGTACATGGCGCCTATTCTACTGGATTAATGGCTGCTGAAGATTGCAGGATGCGGGTA
rJMSF004K06+ TCTGTACATGGCGCCTATTCTACTGGATTAATGGCTGCTGAAGATTGCAGGATGCGGGTA
JMFS054F05- TCTGTACATGGCGCCTATTCTACTGGATTAATGGCTGCTGAAGATTGCAGGATGCGGGTA
                      ____________________________________________________________
consensus TCTGTACATGGCGCCTATTCTACTGGATTAATGGCTGCTGAAGATTGCAGGATGCGGGTA
 
. : . : . : . : . : . :
rJMFF042G14+ CTGGAGCGTTATGGAGAGCTGGATCTGTTCCATCCAGTCATGGGCGAGGACACTCCCGTC
rJMSF004K06+ CTGGAGCGTTATGGAGAGCTGGATCTGTTCCATCCAGTCATGGGCGAGGACACTCCCGTC
JMFS054F05- CTGGAGCGTTATGGAGAGCTGGATCTGTTCCATCCAGTCATGGGCGAGGACACTCCCGTC
                      ____________________________________________________________
consensus CTGGAGCGTTATGGAGAGCTGGATCTGTTCCATCCAGTCATGGGCGAGGACACTCCCGTC
 
. : . : . : . : . : . :
rJMFF042G14+ TCTGTTCCCCTGTTAATCTCCCGCATGTAGAAGAAGAAGAAGAAGATTGTAGCGTGGGTT
rJMSF004K06+ TCTGTTCCCCTGTTAATCTCCCGCATGTAGAAGAAGAAGAAGAAGATTGTAGCGTGGGTT
JMFS054F05- TCTGTTCCCCTGTTAATCTCCCGCATGTAGAAGAAGAAGAAGAAGATTGTAGCGTGGGTT
                      ____________________________________________________________
consensus TCTGTTCCCCTGTTAATCTCCCGCATGTAGAAGAAGAAGAAGAAGATTGTAGCGTGGGTT
 
. : . : . : . : . : . :
rJMFF042G14+ TTGGCTAAACACAGATTGCTGCTGCGGGCTTTGTGAAAAACTGCGAAAACCAGTAAATGA
rJMSF004K06+ TTGGCTAAACACAGATTGCTGCTGCGGGCTTTGTGAAAAACTGCGAAAACCAGTAAATGA
JMFS054F05- TTGGCTAAACACAGATTGCTGCTGCGGGCTTTGTGAAAAACTGCGAAAACCAGTAAATGA
                      ____________________________________________________________
consensus TTGGCTAAACACAGATTGCTGCTGCGGGCTTTGTGAAAAACTGCGAAAACCAGTAAATGA
 
. : . : . : . : . : . :
rJMFF042G14+ TCAAAGCATCAGTTGTTCATGTGTAGTCATTGTCCATGGCGAGATGCATATAGTATGTGT
rJMSF004K06+ TCAAAGCATCAGTTGTTCATGTGTAGTCATTGTCCATGGCGAGATGCATATAGTATGTGT
JMFS054F05- TCAAAGCATCAGTTGTTCATGTGTAGTCATTGTCCATGGCGAGATGCATATAGTATGTGT
                      ____________________________________________________________
consensus TCAAAGCATCAGTTGTTCATGTGTAGTCATTGTCCATGGCGAGATGCATATAGTATGTGT
 
. : . : . : . : . : . :
rJMFF042G14+ GTTTAAAATGTAAACAGTTTCGTGTCATGTGTATGGACGAGATATTCTGGACTGCCTCAT
rJMSF004K06+ GTTTAAAATGTAAACAGTTTCGTGTCATGTGTATGGACGAGATATTCTGGACTGCCTC
JMFS054F05- GTTTAAAATGTAAACAGTTTCGTGTCATGTGTATGGACGAGATATTCTGGACTGCCTCAT
                      ____________________________________________________________
consensus GTTTAAAATGTAAACAGTTTCGTGTCATGTGTATGGACGAGATATTCTGGACTGCCTCAT
 
. : . : . : . : . : . :
rJMFF042G14+ GGCTATTATGAACATTATATTACTGAATAATATAAATCGTGTGGGTTTTATC
JMFS054F05- GGCTATTATGAACATTATATTACTGAATAATATAAATCGTGTGGGTTTTATCAAAAAAAA
                      ____________________________________________________________
consensus GGCTATTATGAACATTATATTACTGAATAATATAAATCGTGTGGGTTTTATCAAAAAAAA