Previous Contig 003307:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS053F10Sequence566003307 (2)gb:AP004765_18446782e-13Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P071
JMSF024C17Sequence133019335748003307 (2)gb:ATH242957_15520792e-38Arabidopsis thaliana partial mRNA for SPL1-Related2 protein (SPL1R2 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF024C17+ CTGTTAAAAGGAAGTGTAGGAAGATGGTTGACCT
                      ____________________________________________________________
consensus CTGTTAAAAGGAAGTGTAGGAAGATGGTTGACCT
 
. : . : . : . : . : . :
rJMSF024C17+ GCTTGTTCACTACTCTATATGTGCTTCTGGTGGAAGCCCTATCAACTATATCTTCACACC
                      ____________________________________________________________
consensus GCTTGTTCACTACTCTATATGTGCTTCTGGTGGAAGCCCTATCAACTATATCTTCACACC
 
. : . : . : . : . : . :
rJMSF024C17+ CAATCTTACTGGGCCAGGTGGCATTACACCTCTGCATTTAGCAGCTTGTACATCGAATTC
                      ____________________________________________________________
consensus CAATCTTACTGGGCCAGGTGGCATTACACCTCTGCATTTAGCAGCTTGTACATCGAATTC
 
. : . : . : . : . : . :
rJMSF024C17+ AGATGACATTGTTGATGCTCTGACTAGTGACCCACAGGAGATTGGGTTGCACTGCTGGAA
                      ____________________________________________________________
consensus AGATGACATTGTTGATGCTCTGACTAGTGACCCACAGGAGATTGGGTTGCACTGCTGGAA
 
. : . : . : . : . : . :
rJMSF024C17+ ATCTGTACTGGATGAAAATGGAGTGTCTCCTTGTGCATATGCTTCAATGAGGAATAACGA
JMFS053F10+ GCATATGCTTCAATGAGGAATAACGA
                      ____________________________________________________________
consensus ATCTGTACTGGATGAAAATGGAGTGTCTCCTTGTGCATATGCTTCAATGAGGAATAACGA
 
. : . : . : . : . : . :
rJMSF024C17+ CTCTTACAACAAGCTTGTGTCTCAGAAGCTTTCTGTGAGAGAAAAGGGCAAAGAAATATG
JMFS053F10+ CTCTTACAACAAGCTTGTGTCTCAGAAGCTTTCTGTGAGAGAAAAGGGCAAAGAAATATG
                      ____________________________________________________________
consensus CTCTTACAACAAGCTTGTGTCTCAGAAGCTTTCTGTGAGAGAAAAGGGCAAAGAAATATG
 
. : . : . : . : . : . :
rJMSF024C17+ TTTAGTGATTGGAAATGAAGTGGAAGAAGAGCAGGAGCATAAACCTCCTACTGCTGCTGC
JMFS053F10+ TTTAGTGATTGGAAATGAAGTGGAAGAAGAGCAGGAGCATAAACCTCCTACTGCTGCTGC
                      ____________________________________________________________
consensus TTTAGTGATTGGAAATGAAGTGGAAGAAGAGCAGGAGCATAAACCTCCTACTGCTGCTGC
 
. : . : . : . : . : . :
rJMSF024C17+ TGCTTGCCAAGTTAACAAGGAACCCAAATCTTGCTCGAAATGTGCTTCTGCAGCGATAAT
JMFS053F10+ TGCTTGCCAAGTTAACAAGGAACCCAAATCTTGCTCGAAATGTGCTTCTGCAGCGATAAT
                      ____________________________________________________________
consensus TGCTTGCCAAGTTAACAAGGAACCCAAATCTTGCTCGAAATGTGCTTCTGCAGCGATAAT
 
. : . : . : . : . : . :
rJMSF024C17+ GAGATATAACAGCAGGCCGAGGAGTCCACGAGGATTGATGTATCGTCCCTACATCCATTC
JMFS053F10+ GAGATATAACAGCAGGCCGAGGAGTCCACGAGGATTGATGTATCGTCCCTACATCCATTC
                      ____________________________________________________________
consensus GAGATATAACAGCAGGCCGAGGAGTCCACGAGGATTGATGTATCGTCCCTACATCCATTC
 
. : . : . : . : . : . :
rJMSF024C17+ ATTGCTTGCTATTGCTGCAGTTTGTGCATGTGTGTGTATCTTCTTCCGGGGATCCCCAGA
JMFS053F10+ ATTGCTTGCTATTGCTGCAGTTTGTGCATGTGTGTGTATCTTCTTCCGGGGATCCCCAGA
                      ____________________________________________________________
consensus ATTGCTTGCTATTGCTGCAGTTTGTGCATGTGTGTGTATCTTCTTCCGGGGATCCCCAGA
 
. : . : . : . : . : . :
rJMSF024C17+ TATTGGCTCAGTTGCTCCCTTAAATTGGGAGAATTTGGNTTTTGGTGCAATTNAATTAGG
JMFS053F10+ TATTGGCTCAGTTGCTCCCTTAAAGTGGGAGAATTTGGATTTTGGTGCAATTTAATTAGG
                      ____________________________________________________________
consensus TATTGGCTCAGTTGCTCCCTTAAATTGGGAGAATTTGGATTTTGGTGCAATTTAATTAGG
 
. : . : . : . : . : . :
rJMSF024C17+ NTGAAGTAAATAGTGTACCAGTAATTCCATCTAGGNTNAGCTAGCTAGGCTTTTTATTTT
JMFS053F10+ ATGAAGTAAATAGTGTACCAGTAATTCCATCTAGGCTAAGCTAGCTAGGCTTTTTATTTT
                      ____________________________________________________________
consensus ATGAAGTAAATAGTGTACCAGTAATTCCATCTAGGCTAAGCTAGCTAGGCTTTTTATTTT
 
. : . : . : . : . : . :
rJMSF024C17+ ATAATCAAGACAGACAATNATATATATCTATATATANGCATGCATGCTAGCTGC
JMFS053F10+ ATAATCAAGACAGACAATAATATATATCTATATATATGCATGCATGCTAGCTGCACTATA
                      ____________________________________________________________
consensus ATAATCAAGACAGACAATAATATATATCTATATATATGCATGCATGCTAGCTGCACTATA
 
. : . : . : . : . : . :
JMFS053F10+ CAAGCTAAGACATTAAATCTGTTACATCAAAAAAAAAAAAAAAAAACTCGAGACTAGTTC
                      ____________________________________________________________
consensus CAAGCTAAGACATTAAATCTGTTACATCAAAAAAAAAAAAAAAAAACTCGAGACTAGTTC