Previous Contig 003304:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS053D10Sequence603003304 (2)gb:AP000740_18206042e-14Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MSD24.
JMFS054D04Sequence596003304 (2)gb:AP000740_18206042e-13Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MSD24.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS053D10+ ATC
                      ____________________________________________________________
consensus ATC
 
. : . : . : . : . : . :
JMFS054D04+ GCTCCTTTCAACAAGTCCTTAGCAACCTCCTTCGACTTCCCGTCTAACCCACCTCC
JMFS053D10+ GAGAGCTCCTTTCATCAAGTCCTTAGCAACCTCCTTCGACTTCCCGTCTAACCCACCTCC
                      ____________________________________________________________
consensus GAGAGCTCCTTTCATCAAGTCCTTAGCAACCTCCTTCGACTTCCCGTCTAACCCACCTCC
 
. : . : . : . : . : . :
JMFS054D04+ CTTCGACCACGACTCAATCACTCGACTCAGCTTCTGAGCTCCTCTCGATACCTCCATGAG
JMFS053D10+ CTTCGACCACGACTCAATCACTCGACTCAGCTTCTGAGCTCCTCTCGATACCTCCATGAG
                      ____________________________________________________________
consensus CTTCGACCACGACTCAATCACTCGACTCAGCTTCTGAGCTCCTCTCGATACCTCCATGAG
 
. : . : . : . : . : . :
JMFS054D04+ CTGGACAGAACACGAGGCGTTTAACTCATCTGCAGACCCTTGGCACACCCTTTCTTCGCG
JMFS053D10+ CTGGACAGAACACGAGGCGTTTAACTCATCTGCAGACCCTTGGCACACCCTCTTTTCGCG
                      ____________________________________________________________
consensus CTGGACAGAACACGAGGCGTTTAACTCATCTGCAGACCCTTGGCACACCCTTTTTTCGCG
 
. : . : . : . : . : . :
JMFS054D04+ TTCTTTCTTCACACTCATACCTTCACGAACTCCTCGTTTTACAAGCTTATCATCATCCAC
JMFS053D10+ TTCTTTCTTCACACTCATACCTTCACGAACTCCTCGTTTTACAAGCTTATCATCATCCAC
                      ____________________________________________________________
consensus TTCTTTCTTCACACTCATACCTTCACGAACTCCTCGTTTTACAAGCTTATCATCATCCAC
 
. : . : . : . : . : . :
JMFS054D04+ CATCTTCGGGAGCTCGGTCTTGGACCTCCTAATCCTATTGCATTCAACTACACCCCTAGG
JMFS053D10+ CATCTTCGGGAGCTCGGTCTTGGACCTCCTAATCCTATTGCATTCAACTACACCCCTAGG
                      ____________________________________________________________
consensus CATCTTCGGGAGCTCGGTCTTGGACCTCCTAATCCTATTGCATTCAACTACACCCCTAGG
 
. : . : . : . : . : . :
JMFS054D04+ ATCATCACACGTCAGAAATGATCTGTATAACACAGATCTCGGCCTGTCTTGTGGCATATT
JMFS053D10+ ATCATCACACGTCAGAAATGATCTGTATAACACAGATCTCGGCCTGTCTTGTGGCATATT
                      ____________________________________________________________
consensus ATCATCACACGTCAGAAATGATCTGTATAACACAGATCTCGGCCTGTCTTGTGGCATATT
 
. : . : . : . : . : . :
JMFS054D04+ CTGTACTATTTCTATCACACAAATTTCATAGAAACATTCAAAGGCTTATTCAAATTCTGC
JMFS053D10+ CTGGACTATTTCTATCACACAAATTTCATAGAAACATTCAAAGGCTTATTCAAATTCTGC
                      ____________________________________________________________
consensus CTGTACTATTTCTATCACACAAATTTCATAGAAACATTCAAAGGCTTATTCAAATTCTGC
 
. : . : . : . : . : . :
JMFS054D04+ CCAGTGGATTCACCTCAACACATATATATATATCTCAGCCAAGCTGTCAAAAGCTTGATA
JMFS053D10+ CCAGTGGATTCACCTCAACACATATATATATATCTCAGCCAAGCTGTCAAAAGCTTGATA
                      ____________________________________________________________
consensus CCAGTGGATTCACCTCAACACATATATATATATCTCAGCCAAGCTGTCAAAAGCTTGATA
 
. : . : . : . : . : . :
JMFS054D04+ TGATGATGTAGACACAAAACACAGCTCTTTTTCAATCTTCAGCTTTAAAATACTGACACA
JMFS053D10+ TGATGATGTAGACACAAAACACAGCTCTTTTTCAATCTTCAGCTTTAAAATACTGACACA
                      ____________________________________________________________
consensus TGATGATGTAGACACAAAACACAGCTCTTTTTCAATCTTCAGCTTTAAAATACTGACACA
 
. : . : . : . : . : . :
JMFS054D04+ CTCTTTTTTGGCTCCTGATGGATAAAAACAGAATCTTTGATCAACCCAATTCTCCTCCTT
JMFS053D10+ CTCTTTTTTGGCTCCTGATGGATAAAAACAGAATCTTTGATCAACCCAATTCTCCTCCTT
                      ____________________________________________________________
consensus CTCTTTTTTGGCTCCTGATGGATAAAAACAGAATCTTTGATCAACCCAATTCTCCTCCTT