Previous Contig 003303:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS053C12Sequence603003303 (2)gb:AP003238_18259893e-50Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040
JMFS075E07Sequence626003303 (2)gb:AP003238_18259893e-52Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS075E07+ TGTTGACATTTAGTATTGAAGAAACC
JMFS053C12+ AACC
                      ____________________________________________________________
consensus TGTTGACATTTAGTATTGAAGAAACC
 
. : . : . : . : . : . :
JMFS075E07+ ACAAATCTACGAGTNTGAGGTCTTACAGGAAGAGGCTCTCAGTTGAATTAAGTCTCCTAT
JMFS053C12+ ACAAATCTACGAGTTTGAGGTCTTACAGGAAGAGGCTCTCAGTTGAATTAAGTCTCCTAT
                      ____________________________________________________________
consensus ACAAATCTACGAGTTTGAGGTCTTACAGGAAGAGGCTCTCAGTTGAATTAAGTCTCCTAT
 
. : . : . : . : . : . :
JMFS075E07+ TTTGCCAAATAGTGGATGGTATAGAACCGCTTAACGAATTGTTTGCAAGAGACAGTCTCT
JMFS053C12+ TTTGCCAAATAGTGGATGGTATAGAACCGCTTAACGAATTGTNTGCAAGAGACAGTCTCT
                      ____________________________________________________________
consensus TTTGCCAAATAGTGGATGGTATAGAACCGCTTAACGAATTGTTTGCAAGAGACAGTCTCT
 
. : . : . : . : . : . :
JMFS075E07+ GCAAACGAGGAAGTTCAGAAAAGCTTGTAGGAATACTTCCATTAAGATTGTTGTTTGATA
JMFS053C12+ GCAAACGAGGAAGTTCAGAAAAGCTTGTAGGAATACTTCCATTAAGATTGTTGTTTGATA
                      ____________________________________________________________
consensus GCAAACGAGGAAGTTCAGAAAAGCTTGTAGGAATACTTCCATTAAGATTGTTGTTTGATA
 
. : . : . : . : . : . :
JMFS075E07+ AATCGATGGTTGTGATATTCCCGGAGAGCCTATTTGTTGGTATGGGCCCTGTAAGTTGGT
JMFS053C12+ AATCGATGGTTGTGATATTCCCGGAGAGCCTATTTGTTGGTATGGGCCCTGTAAGTTGGT
                      ____________________________________________________________
consensus AATCGATGGTTGTGATATTCCCGGAGAGCCTATTTGTTGGTATGGGCCCTGTAAGTTGGT
 
. : . : . : . : . : . :
JMFS075E07+ TAGAGCTGAGATCTACGTAAGTGAGATTAGCTATGTTGCTTAGATCTGGTACTGGCCCCT
JMFS053C12+ TAGAGCTGAGATCTACGTAAGTGAGATTAGCTATGTTGCTTAGATCTGGTACTGGCCCCT
                      ____________________________________________________________
consensus TAGAGCTGAGATCTACGTAAGTGAGATTAGCTATGTTGCTTAGATCTGGTACTGGCCCCT
 
. : . : . : . : . : . :
JMFS075E07+ GCAGGCCGCAGTTCCTGAGACTCATTTTCAGCAAATGAGACATGTTTCCATAAGACTCTG
JMFS053C12+ GCAGGCCGCAGTTCCTGAGACTCATTTTCAGCAAATGAGACATGTTTCCATAAGACTCTG
                      ____________________________________________________________
consensus GCAGGCCGCAGTTCCTGAGACTCATTTTCAGCAAATGAGACATGTTTCCATAAGACTCTG
 
. : . : . : . : . : . :
JMFS075E07+ GTATCCGACTCCCGTCAAAGTGGTTGTTGTCAAGTTGXXXXXXXXXXXXXXXXGGTAATT
JMFS053C12+ GTATCCGACTCCCGTCAAAGTGGTTGTTGTCAAGTTGXXXXXXXXXXXXXXXXGGTAATT
                      ____________________________________________________________
consensus GTATCCGACTCCCGTCAAAGTGGTTGTTGTCAAGTTGNNNNNNNNNNNNNNNNGGTAATT
 
. : . : . : . : . : . :
JMFS075E07+ CAGCCAGCTCTGGTGGAAGGGATCCCGTTAAGTTGTTATTGTCGAGCAATAAGTGAAGAA
JMFS053C12+ CAGCCAGCTCTGGTGGAAGGGATCCCGTTAAGTTGTTATTGTCGAGCAATAAGTGAAGAA
                      ____________________________________________________________
consensus CAGCCAGCTCTGGTGGAAGGGATCCCGTTAAGTTGTTATTGTCGAGCAATAAGTGAAGAA
 
. : . : . : . : . : . :
JMFS075E07+ GCTGGGGAAGTTTAGACAGCTGAGGCGGGATTGGTCCACTTAATGAATTGTTATTCATGT
JMFS053C12+ GCTGGGGAAGTTTAGACAGCTGAGGCGGGATTGGTCCACTTAATGAATTGTTATTCATGT
                      ____________________________________________________________
consensus GCTGGGGAAGTTTAGACAGCTGAGGCGGGATTGGTCCACTTAATGAATTGTTATTCATGT
 
. : . : . : . : . : . :
JMFS075E07+ GGAAGTGTTGCGTTTTGTTCAAATTTGCAAATGAGAGAGGTATTGGACCCGATATGTGAT
JMFS053C12+ GGAAGTGTTGCGTTTTGTTCAAATTTGCAAATGAGAGAGGTA-TGGACCCGATATGTGAT
                      ____________________________________________________________
consensus GGAAGTGTTGCGTTTTGTTCAAATTTGCAAATGAGAGAGGTATTGGACCCGATATGTGAT